Description :
From Genome Similarity Track
Location :
Scaffold_709:710- 2102
Sequence
1392 bases(100 bases per row)
GCAGGTAAGCCTTCTGGCACCCGACATAGAAATTTGGGTGCAAACGCATAGTGGTAGGTATGTCTAGCGTGTAAGCATCTCCATGTGCCTTAACAACCCG
AAAGGGGCCAATAGATCTTGGCGCTAAATTATAAGCCCAAGTTCGTCGCAGATGTGTCTGGTAATCCTCTTGTCGATAACAAGACTCTGTCACCTTCTTT
GAACGTCAACGTGTTCTTTCGACCTCTCTTGTGAACGTTCTCCTTTCGTTTATCCACTGCTTTTTAAGGGCATCAGGTACAAAACGTTCTCCTTTTGTTT
ATTCACTGCTTCTTGAAGGGCATCACGTACAAAACGCATGATGCCTTGTCGTAGTTATAGGAATTCGTTCACAGCAGCCGAACATACAGGTGAAGTGGAA
TCTTAAGGAGAAACATTAGATACTGGAGACGCGATAGGATACATCGCGACGGGACTCGATATGCCATTGTCTACGAACTTAACAGCATAAGCTGCATCGG
CAGCAACCTGATCTTTAACGTAATCAATCATCAAATTTTTCGGCGTAATACTATCGGCAGGTACTCCCCCACCAAGCTTACAAACCGGGTGTTCTGAAGC
TGAAAGAGCAAGAAGCGCTGTAACGCAAGGGTGCCTCGCGTTGTTCACAAAAATGGCGTCAACCCTGTTGACGCATGAGCTGCATTATTGATTGCAAATT
CAGCGAGTGGGACCAATGAACTCCACGACGTAAACGATGTCGCATAACTGCGCATGACATCTGCAAGCACTCTGTTCATGCGCTCCGTTTTCCCATCCGT
CTCTGGATGGGCTGCCGTAGCTATAAGCAATCGCGTGCCTAATAGTTGAAACAACTCTGCCCAAAAAGTCGACGCGAAACTCTATTCACGGTCCAAAACA
ATGGATTCTGGCAAGCCGTGATGCCTGAATATGAGATCGAGAAAGATCTTCGCGGTCGTCTCCACCGTAACGTGCGCGGAGACTGGATAAAATGAACCAT
TTTGCTAAATCGATCCACAAGAACCAGTACACCCGTGCATTTCTGTTCAGCCGGTGGACGACCAAAGATGAAATCCATGCTGACCGAACGCCAGAATTCC
GTGGCAATCGGAAGCGGTCGCAATGGAGATTGTGAATACGGCGCAGGCTTTACACGCTGGCATGTTTCACAGGAGCGTACCCATTTCTGGATGTAATCGT
TCATACGCGGCCAGAAAAAAACACGAGAAATGGCCGCGAGCGTCGTTTTGCGACCCAGATGACCACCAGCTGGAGTGTCATGAAATTCATGCACCAATCG
TGCTCGGAGTTCGTCATCAGTAGGGATGAAGACGCGCGATGGGTCAAAGCCGTCCATTGTATACGTCAGCAGCGGACCATCAAGCGCGTAAT