Description :
From Genome Similarity Track
Location :
Scaffold_446:71- 3964
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_16920A disintegrin and metallopeptidase domain 1a
Sappa_CBS223.65SPRG_16921Mannuronan C-5-epimerase

Sequence
3893 bases(100 bases per row)
CGCGCCTTGTACGCAAAGACAGAGGCGTAGTCGTTCCCGAAGTCGTGTGTGTCGTGCGTGCTGCGGGGGCACGAGGCGTGGGCGCCGTTGCAGAAGAGGT
TCGTGTCGCAGAGGTCCTCGGCGACGTGGCACAGCGTGTCCTTCTCAAAGTGGTCGACGCACTTGCCGTGGCCGTCGCAGTAGTCGACGCCGTCGCACGC
GTGGTCGGACGACTCTCCGATCGGCGTGCACTCGGTCGTTCGGGATGCAAACTTGTCGTGGGGGCATTTGCCGACGTAGCCCGTGCAGTATTCGGGCACG
TCGCAAATATCACTCGCATGGCGGCAGACCACGCTGCTGTGGAGAAACGTATCGATGCAGCGACCACGCCCGTCACAGACATCGACACCGTCGCACTTGC
CGCCGCTCGACTTGCCGATCTCGGTGCAGACCTTGCCCACGGGCGCGGCGAGGTCGTCGGGGCAGACGCCACACTCGCCCGAGCAGTACTCGGGCTCGTC
GCAAACGTCGACTGGTTTGCGGCAGAGATGGTTCGTGCCCTTAAAGTGGTCAATGCACTTGCCGTGCCCGTCGCAGCGGTCAACGCTGTCGCATGCGCCG
CCCGACGATTTGCCAATTGAGGTGCACTCGATGCCCTTGCGTGCAAAGCTGTTGCTGGGGCAGTCGCCGCTGACGCCCGTGCACGTTTCTGCCTCGTCGC
AGACGTCGGCGGCGCGGCGGCAAACGTGTTTGTTGGACTGGTACATGTCCACGCAGTGACCGCGGCCGTCGCAGTAGTCGGGTGCGTCGCACGGGCCCCC
TGTGGACTTGCCCATCTTGGTGCACACTTTGGACGACGGCGCAAACTCGTCGTCGGGGCACTCGCTGCTTTCGCCACTGCAGTAGTCGGCCGCGTCGCAG
GCGTCGCGGGCACTGCGACAGACGATGCTCTGGTCCTTGTAGCCGTTAAGGCACGTGCCGTCGCTGTCGCAATAGTCCTTCTCGTCAGCGTCGCACGGAC
CGTCGTTGTCGCAGCTCTGGCCCGGGCAGAGCGTGCCGTGCGGCAGCGGCGTGTACGTGCACTTGCCATTCACAAAGTCCGAGAGTTCGCGACACGGAAT
CTCGGGGCACCCGTCTTCGTCGGCAATCACCTCCACGTGAACGTCGTCCCAGTACTGGCCGTGATGCGCGTGGTCGTCGTGCGTCGACCGGTACCGAGAC
GCTTGGGCGGCGCTCAGAAAGTCGTATGGCGTGTCCTTGATCGCGTCGGCTTCATCGAACGCATCAATCAAGCTGGGCTCGTACTCCGTGTTGTGATCTA
TGCCAGCAGTGGGTTTCTTCCTGGTTTAGTGACGACGCTGACTCACCGTTTGCAGCAGCGAGGATGCGGGACGCCGTCGTGGCCTCCACGCCGTGCTTCG
ACGCGACGGATGCCCCCTTCTTGTGGGTGTTGGCGTGGGCGGCAATGGCCATAGCGAGGCAGACTCCAAAGCGAACCTTCATCCTTGGCGGCAAATTGAA
ATGTGCACAGTTGCGGTGCGCCTGGAGCGCAAATATTTGTGACCAATCACACCGCACGACGTCTCATCTGCGCCAATTAGATTCAAGACTTTTCGTACAA
TGAAACTGGTGGGCTTTTCGTGTTTTAAAGTCACATATAACTCCTGGCGAAAGATACGACTTTTCCCGCGCCGTTTGCTGGCGCGTGTGTGGGGCGTCGT
CGCTTCGCGGACATCAAACGACGTCGAATCATTTCACGGAGAATGGACGACTGAAGAAATACAGACTGCTTCTGAAAGATAGTCCTGCTGGGATAAGAAC
TCATTGACGTAGGTGTTCAGCCCACTTACAGGCTGGCTCGAGGGCCGCTGTTTGGGCTCTGTGTGAGAGCTTTGGTGGCATGCAGTCAACACCCTTGCGC
AACGACTGCATGCGAGAAAGGCCGCCGTTGCCAGCGCGCTGACCTTGCGATCTGGCTCCTGCAACGCATCTGTTGCAATTTTCACGACGAAACACCAAGC
TCCTTTAAAACGTTGGAACAAACCGACCTCATTGGCACGCCGTAGTCATCGCAATTTACACTTGTGGCGACGATGCCCCGTTCCACTGCAATGAGAATGC
GATTCATGTGAACTTTTTGGACTTCTTACGTCCAAAGCTATCGCAACCTGTGGAGCCATTGGGGTGAGAGGCTTAACAATGCACTTGCCTTTAAAACTCG
CGGAGATGCGATGTCGTCCATCATCACATGTGTGAAACGTGTGAAAGGGTCACCTCACTCTCCAGAGGTCGCAAAACGTGAGAAATACTCCATTCATATG
ACGTGAGTTGTATCTGAATGATTTGTACTAGAACAACCCATGCTCCAACCAACACAAGCCAGGACATGGCCTTATTGGTCGCTTATGGCTGGAGACGCCG
TTGGGGAATGGGCGACGAGCTGGAAGATATATTTATCTCCATCTAGGTATCACATACCGAGGACAAGAGTCCGGGAGCGACGCATCGGCAAATCTTGTAT
CGGCACCTCTTCGAGTGCCCGCGCTCAAGTCCGCGAAGTTGAAAAAGAGGCTCGCGGATGTGCCGCTTCAGCACCTGTACTTGGTCGTGTCAGCGCTGCC
GCAGCGGTAGAAATGGCATTGCTTCTACTTTGGGCGTCAACACACTGAAAGATAAGTAGGTAGTCTACCGAGAGAAGCGCCGACAGCGACAACGTCGAGC
GCCTGTGCCAGGACCACCCTTGTCTCGCTCGCTCGCGTGCCACGTCATGTCCACGTATCCGGACACACTCCGGATACCACCAGCAAGTGCAATTGCAAAC
GGTCGAGGCGACATCAGCGCGGCAGAAGGAGCTGCACGAGCGCGCACGACATCGCGTGGCGCCGAGCTTGATGGATGCTAACTCGAGCACCCACGCATGA
CGTCCTGACGCTTGCACACGGCAGCCGGCGCGGAGACTGCTGCCAGCGCAACGACAAGTTTGCGCCGCAGCGAGCCTGTCGTTCAACTAAATGTCTGCTC
GAGCTGCCAACTTCGCCCTCGGTGGGCACCAGCAGTGGCTGCGCGCCCTTGGTCCACGGCGCCAACGCGAGCTTGGCACCGACCTCGTTCGTCAAGCCAT
GGGCTGTTTGGGTTTGACACACTGCTGCGAAACCTCATTTGTCTCACAGAGCGACTAGGTGCCTGAAGCGAACGAGGTTTTGACCCTGCCGCGGCTCGTC
GTCGCGAGCGTGTGTGACCTGGCAAAAAACATGTGCGCGCTCATTGTGCCAGGTCTGGACGACTTTCGCGAGGCGGTCGAGTCGACGCCCTTAACGCTGA
CGCCGTGGTCGACCAGACACACAGCCGAGGGCGTACACTGTAGTTCTCTACAATGCGCCGTTAGTGCAATGGTGGCACGAGAAAGCGCTCTCGGCACGGT
ATCGGTCGGAGAGCTGCTTCTCAGCGAGACGACGAGGCCCACGCTCTCACTGCTGCGCCTACAGACGACCCGAGCGGTCCTTTGTTACCATGGCTATCGG
CAGGTATTGTTTCTTTTTATACTCTGTTTGGTGTAACACTGGTTTGTAGCTCAAGTCGATGGATCGATGGCAATAATCGGTTCGCGATCTCATCGAGGAG
TATCTAATGTCTCTCGCCTGTAATCTTATCTCGGCGTTGCGGTGTACGCTCATTTGTTGTACGCGATGTCACGTGCGCGTCATGCCATGTCGTCACTAGT
ACCCTTCGACTCTGTAAATTCGATGTTAGAGTCATGGATAGGTGTCGCTACTGCCTGCGGGATTGACTGTATTTATCTCGTCGAGATCACTCGATGGACC
GTTTGCAGCTCTTCTGGGCGACATGCGCAGTGTTCTCAGTGCCTTCTTCACCGAGAGCGCACTGCACGTGCCAGCGTCGTTTCTCCCGGAGCA