Description :
From Genome Similarity Track
Location :
scaffold_538:71- 3659
Transcript NameFunction/comments
g9084.t1hypothetical protein

Sequence
3588 bases(100 bases per row)
CCCTCGGTCTCTCCACTCTCCGAGTACCACGCTCTTGGCTTCTGTGTTTTTTTTTTTTTTATAGCGGGGGGGGGGGGTGGGGGGTGGGGGGGGGTGGGTG
GGGGGGTGGGGGGGGGGGGGGGGTGGGGGGGGGGGGGGGGGGGGGGGGACCAATACGATTCGTAGTTTCGGCATTTGACTCAAGTATTTCGACGGGTGTG
CCACATCCAGAAGCAGGTGGAGTAAGAGCTTCAAGTCGTGGAGACTTTCCTCCTTTTATACTTCTAATACATTTTGAGTGCGATCTGACAAGGGCTCCCG
AATTTTCGGCTGAGTGACTGGAATATACTGCTACAATCTACTCAAACAATAGTTCTTCAAAGAATGGGTTCGATCCACCCAAACCAAGAAGCTGACCCCA
ACCAAGTGACCGAATTTGGATTCTCCGGCAATAATCAAGAAAAAGAACTCTAAGTAGATACAACAAAACGACAAGGCCACTAACTAGCTAATCAACTTCT
TCTTCCACTACTGTTGTATCATGTTTTGGCAAAAACTAATGTTCCTAACGCCAGTTTCGTAATGTCTTGTAGAATTTGGAGTATCCGAGGAGGATCTTCG
AGTCTCTGCTGTCAGCCACTACAAACTTCTCTGCAACTGGACTAGGGGTCAATTGCTCGCCATTACGCCATGCCCCGTACTGAAGCTCCAAGAATCGCTC
AGTGAATGCTTCCATGCCCTTGGACTTGGCTTGAGCATTCGCACCACTCAACATTATGGCGAACTGAACGTCACCAAAACGTCTCCACAACCTAGAGAAG
GCCAGTGAACTATCATCGAGCTTGGTCACGTACGAGGCCCAAACGGCTGCCATCGGGGTGTCAAAGAGCTTCGTCCCTTACGCCTCGAGCTTGAGACTGG
TGAAAAAATCGTCAACCGATTTTTCTTTAGCGATCCAGTCTTTGAAAAGCGCCCCCTGCGTACTTGTAGCAATTGATTTTGTGCTGTCCACTTCCTTGGC
AGAAAGTAGCGTCTTCACGAGGCCCCGTCGTCGTAAAAGGTCCTCAGTCGTAACAGTAGCAACTCGTACGGATCCTTTTTCAAATATGTCACGTAGGATG
TCCAAACATTTACGATCGGGTTCTGTAACAGCTTACCACCCTCTTCATCCAGCTTGAGTAGCTTCAGCACATCGTCTGCGGATTTCCTGTTTCGTGCCCA
AATTTTAACCTGGATTTCCGCAAACTTGTCGGCGACATTCTTGGTACTTTCGACGTTCTTAGCCTCCAGCAACATCTTCGCCAAAACTGCGTCGTCGAAA
CGAGACTGTAGTGCCTTAAACACCGTCTGATCGGGATAGTCAACACCAACCTTGGTCACGTAGGAAATCCAAGAGTTTACAACAGGACTCTCAAATAATT
TACTCCCTTTCTGGTCAAGCTTGAGCAGCGTGAAAACGTCATCTGCCGTTTTGCCTTGGGCTAACCAATTGTCCAGTTGAGCATTCGCCAGCTTCGTTGC
AACAGCTTCGGTGCTTTTCGAATTCTTCGCTGCGATGAGCATATTGGCCAGAGTTTCGTCGCCGTAACGAGCTGCCAGCGTCGTTGCCATTGCCATGTCA
GCAGCGCCAGGGTTCTTCGAGTTCGCCTTCGTCACACCACGAGCCCATTTCTCGAATTGGGAGCTGCTAAATAGGTTGGACTTGGCACTGGTGACCTCGA
ACTGGGTGAACAGCGTGTCTGCAGACTTTCCGTTGTTTGATTTCAGCTTCCCCAGTAGTGCTTTCGCCGATGCGCCGATCTTTTCCACCACTGGTTCAAA
CGCCCTCTCTTCTGAATCCTCATCGTCTTCTTCAGCCGAAATTGTCTTCGTTTCAGCTCTTAAACGTCGCGCACCCTCGACATCATAGGGACCTCCCACA
AAAGCTGCTGAGTTGGTGGTGGCTGCTATCGAGTCGGGAGTGAAAGCGCTACACGAGATGATAAGAGCTGCAAATAGCAGGAAGACGCAGCTGAACTTGG
CCGACTTGGACTTCATACGGGTGAGAATTGGAGTTTCGAGTTCGGCGGCAAATCAAGAAATGTGAAATGAACTACAGATTGACTCAATGACCAAGGATCG
ATAAAGCGGATAGGAAATTGCGTGTCATTTTTTTTTTGGTTTGAGCTAGACCGCCGTCTGGTGAGTTAGATAACAAAAACAATGATGAGCAGCGATCAGC
ATATCTTATTGATACAGTTCAGATGTTCGGATAGCTTTGATTTGACTTGTAAGTTAGTAAAATGGTGTCCTGAGATAGTAGGTGCTCTTCTGGCGGCAAA
ATTTACTACTGTAGTAACCTTTTTTATTGGCTTGTACTTTGGCTTCTGTATTAATGTGCACCTCGCGCTGTCAATAGGAAAACGTTCCAAGACGGTCAGC
TTTCTGTATTCGGCTTGATAACTGTTTGATTACGAGATAGACCAAGGGTTCTCTTCCGTGCAGATTTGCAATCCTATCTTCAAAAGCCTACGGCTCTCGA
CCATCATACAAGCGTAATGTCCTCGTAATACAAGCGTAATGCATGTACCCTGAAAAAATTTCAACCAGTTTTCACTGAAAAAGGGCTGGATGTACACTTT
GATGGAGAAAAAAAGTCAAAGTGCGCCTGCTGAGATAGGACCATGTTTGCCCTGGTACAGTGAAAACCAAGCCTTGGTGGTGAGCTTTTTTTTTCCAGAC
ACAGTCAATCTATCTGCATGAACTGCTATTCGGTCGATATACTTCTTTTGAAGGCATTAATGGGACTACATGTAGCGATACTGAGCTCGTTCGACGATTT
GGTTTCGATGCATCTACATGTACAGTTCTACCTCCAAAATGGTTCCTAGTCGAGTCATTTCTCAAGCTTTTGCTAACGAAGTCTCGAAGTACTTCGAGTA
CGAAGTAATTTACCAATATTTGGCAATAGGGCCACTAACAACAAAGCGAAATTGAAATAACACTTCGACGTAACTTGCAACTTCAGTAGTTCTGTGGAGA
GTCCACACAGCAATTGTCTTTCATGCTACTTGGCGTTTGCGCAACAAGATTCACTTCAAGGAGACTGAAGTGAGCATTCAAAGTTTGTTGAACTCATTTC
ATCGTCATTGTCAACACATCTACCTGCATAGGGAGGAGCTCGAGCTGAACGGCGATGCAGTCATTTCAGTTCTTCAAGGAATGGGTTTCGATCTACCCCA
ACCGAATTTGGATTCTCCGACAATAACCAAGAAGTCTAAGTAGATACAACATAGCTAGCAAAACGATAAGTCCACTAACTAAGTTAGTCAACTTCTTCTT
CTTTTTCTTCTTTAACTTTAGTATTTGATCGTGCAAAGTGGCCTTGTCCGTTAAATTTTTGTTTTGCAAATTTAACTTCAAGCATAATAATAATAAGACA
AGTCGTGCCCATTGACCAACCAGGACACTGCGAGGCATTTTTTCACTACGAGTAACTAGCCAAAGGAATGCTCGACTCGACAGTCGGCAGGTTCTTCATC
GTTGCGTATGACGGTCTCATTCGAATTCTTAGCACGACTGGAAGGTACTGGAATAGCATTCAAGTGGGGCATCGAGAGCGGTATTCGG