Description :
From Genome Similarity Track
Location :
Scaffold_3526:71- 2521
Sequence
2450 bases(100 bases per row)
CCCACTTGAACTCTTCGGAAAGTTACCGAGAGGAGCAGATCCCGCCCTACCGACGGGTACACAAGGTGAGTTTAGCTCAGCAGAACACGGATCATCGGGG
GACCCCCTCCGTTAGTCGGTGTCTGGGCGCAGTGGGTAAGTTGGATCTGGCAATCTCGCAGATTTTGCTGATCCCGCTACACCACAATGGTGCGCGTGCC
CGGATCTTTTGGTGACTCGGGATTTTACCGTGAGTCCCAAGAAGATGCTCAAGTGAAGATTGAGCCAGGGGAAGAGGCGTCGTCGGAGGTCGGATCGACG
AAGACGCTGCTGAATGAAACAAGATCCGCCGATCGATGGAGTTTTGGGAGGAGCTCTGTCGACGGAAGAGAGGTGGATCCGGATCTAGAAGGAAAACCTC
TCTATCCTCCCCAGGTCCCCTCGGGGACCCCTGCGGATCTTGACGCAAGTCAAGATCCGCTAACAAAACAAGGGAAAGTGAAGGCGAAACGGTATGCATT
TGCAGATTCACCGGTTAAGCCAACACTGTACCTAAACCCAACCCCGCTAGTCGAAGAAGCGAGAAAGAAGACGAAAACGAGTAAGACTACGCGGAAGAAG
ATGCAAGCTACAGAGTCGGAAGAAGACCAAGCTGGATCCAGGTCAAGCTGGTCAGACAAGGATCTCGAGTTTGTGTATCGCCACCAAGCCTTTACGCGAC
TTCCTGCATCAAGATCCTGTCATGCAGATCCTGAATCCCACGACAGATCGCCGATCCAAGGGACCCGGTAAGAGCACCCAACGAAAACGGCGACCAAGTT
GGTGGCAGTCAAAGACCTATTACGTTTGCTTACGGATCCAGGCATCGTAGCTGGTGTGTTCGACGCAGAGGATATCTTCGTGCTAGACCTGGATCTCATA
GTATCCGCGACGCGGGACCTCTTTGCCAGAGTTAAGTCCATCACCGGAGAAAGGTCGCGCACTATGGATCCGGTGTCGTCGCCGAGGATCAGCCAAGCTG
CGTCCTCGAACTACGAATCCGCCGCTGAGGATGAGTCAGACACGTCATCCGAACCACGACGCATGACTTTGGGACCCTCCAGGGCATCCATGCTGAAAGC
GCGGGCGAGGATCCGGGGACAGGAAGTCCCTGTAAACGTGAAGACTCGGGATCCAGTACGCCCTACCCGTGATATGATACAATCCAGCCAGGATTGAGCC
AGATCCGGCAAGAAGCCAGTGGGATTATCGTCAGATCGGGCTCAAGGTAATCGCCTCACGGATCCGGTCTCGCCAGTGGACCCGACGATCACAGGTTCTT
CCGACACTTCCTCGGGCACCCTGCAGCGACACTTCGAAGCTGCGATGAGTCGTTTCCTGGCCGAACAGGGTGTGAGAGCGCCCGTGCCACAAGTGCAAGT
GCTCCACGAACATGGAGCACGAGACGTGGAGATGGAGTCCGTGGAGATGGAGTCCGTGGAGGGAGACAACTCCCATGATGAGTTCGACCCAGATGATCTG
GATGGCCCATCCACTTCGTCAGCAGTGGTAGCAACAGCCACAGCCGGGGCAGGTGGATCATCCATGATCCAGAGGGTACGGATCTCAGCCATATCGGATC
TGAAGGAGTTCACGGGCAAGGATCAAGATGAGGACCGAGCGAGAACATGGATCAGCAAAGTCAAGTCGGCCCTCATGAGAGATCAAGCGTCGGATGCTGA
GAAGTGTTTGACCTTTGTGGATCTGTTAGCGGGGCCAGCCAGGAACTGGTATCGGCAGCTGGGCAGATCCACCCAGGAACAAGTGGCCAGATTTGCTGCG
CAGTTTCCAGACCCAGTACTGTGGATTGGGAGTCTCGGTGGCACGACAATACTACCATGCTCGCCGCAGATTGGATGAATCCCCGCTACAATACCTGCAT
CGACTAAATGTGGCCGGTCTACGGGCCAAGTTGAAGATCAAGGATGGGGGATCCAAGGTACTACAGGAACATGTGGACCATTTCATCGAGACGATGGGAG
ACGTGGATCTGGCCGACAGGCTGACCCTGTTACGTCTTCCAGACGCAGACGAGCTTGAGGAAGTGCTGCGGGCTGTGGATCGCGCGAAACACCGTCAGAA
GAAGGCGGCGGTCGGATCCGGCAAGTATCGCCAAAAGGCTACGACGCCTACGGCTCCAGCTCGACGTGTCCACCAAGTCACGGCGCCCGACTCAGGAACT
GAATCAGGATCCGACAGCTCGGACTCCAACCCAGAGGATAACCGTCGAGTCTGTCTCACAGCATCCAATGATCGAATGGCGAAGACCGGAGACAACTCTC
GACCGAGGGATACCGTACCCGGGGACCGTGGGATGTACAGATCCCGAGATCTCATGGACGGGACAGCACAAGTCAGGTGTTCGCAGTGCGGATCCCGAAA
GCACACCGAATCTGGATACTGGAAACATCTGGTCTGTGAGAAATGTGGCA