Description :
From Genome Similarity Track
Location :
Scaffold_802:71- 2241
Sequence
2170 bases(100 bases per row)
CCGAGTTTGTTGGTGGAGCAAGGCACAGCCGCTGCCCGGTTTTAAGGGAGACAAAAAGCACTGAAGTGATATGCAAGCGTTCAACTGGGTGGTTCGTGGT
CAAACTGTCATCGGATGTGTGGATGAACATTTCAAAAGAGCACAATTTGGGCGTCCCAGTTGACACTTTTGGGCGTAATTTTAACATTTGCACTGACACC
GGTTGGTGATCGGCACGATGGACTAGCAGTCGCTGATGATATAGAGACAGTTATCAGACAAGGACTTGACGAGGGGTGGAATATTGGTGCTATCATTTAC
TGATAACGCCGGGACAATGTGGGCGTGCGCGGCGTATATTGGCTCTTAGGTGGCCACAGCTCGTTTTTGTGCGCTGTTTTGCGCATGACATTAATAATCT
CGTTAAATCGGCTCTACAATCGGTGTTTCGCGGAGTAGCCGGCAAGGCAGCGGCTGCCGTTAATATCATCAACCAATCATCTGCAAAGTGGCTGCAACGC
GTACGAAGGCTAATGAAGAGGTTCTACGACAAGACACTTGGGTTACGAACACTCTGTGCAACTCGCTGGAGCTCCATGCAGGGCTGCTTCGCGTCACTTC
TTCGAGTAAAGACCGCTCTTCAGATGCTTCACCACCAGTACGGGATGGATAGCGACTTTCCATCGAGTCTGCGCTGTTTAGGTGATGCCGACTTCTGGAC
AAGTTTGACTAGTGCTGAAAATGTTATTGCACCGTTGCCGTACGCATCGTACAGACTCCAGCGCGATGAAAACACTGTTGGTGACGTAGTGATATCCTAT
CGTGATATTTACCTCGGATTTCGGAATATTGCTGGTAGTTGTGATGAGCTCGTCAAGTGTGTCGAGGAAAGATGGCGGCAGTGTGAGCAACCGCTCTTCA
TGCTGGGGTTTGCACTGCATCCAGCGTATGCAGATCACGCTCGAGCGCTGCCGACTACGAAGGTCTCAGGGTTGGGCCGCCTTCCTTCAATTGCTGTATA
CTATTATCGCAGGCTATTCTCTACAGAGGATGTCGGCGTCATTCGAAGTGATATGCTCGACTGGATGGAAGGCAAGTTCACAAGAACTAAAGCAAGTGAA
TTTAAGGGCTCTCCCTGGAAATATTGGCGATGGGTTGGCCAACAAAGACCAGACAGTATGCTACCAAAGCTTGCGATGGCAGTATTATCCATTGCTGTCA
ACACTGCTACATGTGAACGACTATTCAGTGAGCTCGGGCTTATTCATACAGCACTGCGCAACCGCATGAAATCAAGCAAAGCACTTGACATTCACATCAT
GCGAAGCATGTTCGTCAACGATCATTGAAAAACTCGGTTCAAAATGCAAACAAAAAGCAACTGATATCACCTGTGGAGCGTGAAATTCTTCGCGAGGGGC
GCAATATAATGTTTGTCCCTTCGCCACTAGGCCCGCTGCATAGCACGGATGAAGACGGTGACGAAGAGGATCCTGGTGACGGTATCAGCGATGGAAGAGC
TCTCGCGGTTTGGGCTGAATATCTGGAGGAGGTTTTTCGTGATGAAGAAATTGACTCGCGGTATGCTGCTGCTCAATACAGTGTGCCACGTAATTGCATT
GACGACGACAACGAATTTGAGGCTATCCCTACGGCAGTTAGCACGAATTTCCGGACGAGAATGACCCTGATTTCCCCCAAGAAGAGCTGCGTGGATTTCG
TGCTCAAAAGGCCACATTAGAGGATCTTTTCGCCCCCCAAACGAGCGAGTAGTGGTGGTATCAGTCAGTTAAAGCTGAAGAACACGGGCGAAGAAACTTT
CAGCCTTACTACTACCTCGAACCCAAGTGTTTGCCGTGCTAGTCGGAACATTCGCATATGTCGTCAACATCCAATTGAGTATTGTGTGGTGTAGGGATTT
CCAGATTCGACCATACGCCAACCTACTTTAGGTCAAGAATCGGCACGGTCTGATAACCCAGAGTTTAGGAGCAAAGGATCACGGTAAGTACTCGGCGATC
TGTCCGGATATGCTATCCGGATGGCTGCTGAGCTCAACGGTCGCCGGAACTCAGCTGAAGGGTCGGTAGAGATCCGAAACGACTACATTTCACTAGATAT
TTGTATAAGAAGCATAGGATTAAATAGGGGGAGCCGAAATGGCTCCCAGAAGATAACAGAGCAGAATTTT