Description :
From Genome Similarity Track
Location :
Scaffold_1059:71- 1282
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_1059-fgenesh-gene-0.0Protoporphyrinogen oxidase

Sequence
1211 bases(100 bases per row)
TAGGCCCACTCGCGGGTCTCTTGCGTCTCGAGCATGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNCCCGTCACGCTGGCGCAGGTGGAGCAGCGACAGGAGCTCGGGCTCGACCACGTCGCGCTGGCCCGTGAGACTCTTCTTGACCGTGTAGTCCGG
TGTGTACGCGTCGGTTTGGGCCTCCGAGTCGCGGTACATGGTCTGCACGCCCACGGTCCGCGTGGGGCCGAAGTCTTCGTCGTCGTCTTGGCGCCGCGCC
TTGCCACGGGCCGACGGCACGACGGCGGCCGGGGGCGCCAGTAGCACCTCGGGCGGCTCGGCCAGTAGGTACGGCAGAATGGGCCGCTGGAAAAACTTGG
CGCGCTCCGTGCCGCTCACGCTCGCGTAGCCCTCAGTCATGTTGCTAGTAGTATTGTTGTTATTGCTGGTGGTGGGGCCATTGCCTCTCAATGTGGANNN
NNNNNNNCTGCTAGTGGTCGTATTGTTATTGCTGGTGGTGGGCCCATTGCGTCTCAGTGTGGAGGCCGCGGTGGAGACCCCCGAGGCGCGGAAGCTGCCC
TTGCGGAACGAGCCACCCGAGTGGGAGACGGCGTAGACCGGATCTACCAACGCACGAGAGGATCAGTGGTCATAGAGAGAGGAACGATACGCCCGTGAAG
CACGCACCGTAGACGGCGTCCAGTGCCCGCGACGGCATGGCGCGAGACATGGTGACTCTCTCTCCTGTCGGCGGCTGTTCAGCTGCGACCTTCACGTGAC
CTCGCTCATACTCCACGAAGCCGTTTCTCTCTCAGTGCCATCTAAATAAAACCCTCGAGTGAAAGAATGAAAACCAAAATCTCTTTGNNNNNNNNNNTCG
TGAGGTCGCTCTCCGAGAGCGATGCGATCTGCGGAAAGTGCGCGCCGCCACACATGACGCTGAGCCGAGTCTGAAGAGCACTGGCGTTCTGCGATGGGAA
CGAGTTCGAGTCAAAGATCACGCCGAGCACGCGCTGCTTCTCGCACGATGGGATCAGATACCCAAAGCCGTCGCTCTTGAGTACGGCGCGATTGTACCCG
ACGTGGACTGT