Description :
From Genome Similarity Track
Location :
contig_62:71- 1217
Transcript NameFunction/comments
g11385.t1hypothetical protein

Sequence
1146 bases(100 bases per row)
CAGCTGCGCGCCTGGGTCATCCGCCGGATCTAGCACCTATGGCGGGGTCGCCTCGTCCTTTCTGGTCCTTTTCTTGGCGGCATCGCCATCTTAGTCCGGA
TCTGTCCAACTGTCATTGTCTCGGGACTGTGACTCTGCATTTCATTTCCGATCGCACTTTCTGGAAGGCACTTCACCACAACCGCCTCCTGCGCGTAGTT
GTTGCCGCACAACGGCATCACTGCGGGCACGCCTCCATGTACTCCCGTCTTCCTCGACACTTCCGCCACATGTCTGCTTCTGGATCAGCCTCAGGACGCT
CCATGGGTGGCCAGGATCCCGGCGGGCATCGGGCGCCATCGCCCTCGTCAGATCAATCACCGCCAACATCGCCTGTCGCCGCCAGGTACACGATCTCTCC
GAGCGGGCGGCGTTACTGTCATCTCAGCTTCGCATCGCAAGGGAAGCTCGAGACACCGCCCTCCGTGGGGAGGAGCATGCACAGCGAACCCTCGTACGTT
CCACTCAGGATCTGCGGGCCTGTGAGCGAGTGTGCGATCGTCAGCAGGAGGAGATTGCTCGCCTCCAAGACGGTCGTTCATCTGCAGTCACGATCCGATC
CGGGTGGTGACCAGCCAGATCCGATCCTGCAATTTCGTCAGAGAGCGGATCGGCATACCGCCATAGTGTCTGATCTCGAGCGTGAGCTTCGCCACGTTTC
CCGTCAGCGAGATGGGTATCGCGGAGATTGCGATCGTCTGACTCGCGAGATGGGGCTGGCTGGCGACGAGGCTGAGACTGCTCAGGAGGAACGTCTCGAG
GCCGAACTCGCTCTGGAGCACGCCAGCCACGAGTTGCGAGTATCCGGGGATCTTCTGGAACGCCTACGCGATGATCTTCATGCTATCGAGAACGAGGCGG
CGATCCGGAGCGCTCAATTAGATCAAGCACGGGCTGCGGCTGCGGCAGGTGATTCCACCCACGGGGAGCTCCAGCGCCTCCGGGACGCGTTGGCGCGCAC
CGATTCGGACCGAGATCTCGCCCGATCCGAACTCGCTGTTGCTCTAGCCGACCGCGCGAAACTGGACGCTGATCTGGGTCAGAAAACGCAGGATCTTGCC
CGTCTACAGGGCGAGATCGTCGGTTTGAACGGTCACGTAACCGATC