Description :
From Genome Similarity Track
Location :
contig_62:71- 1216
Sequence
1145 bases(100 bases per row)
CAGCTGCGCGCCTGGGTCATCCGCCGGATCTAGCACCTATGGCGGGGTCGCCTCGTCCTTTCTGGTCCTTTTCTTGGCGGCATCGCCATCTTAGTCCGGA
TCTGTCCAACTGTCATTGTCTCGGGACTGTGACTCTGCATTTCATTTCCGATCGCACTTTCCGGAAGGCACTTCACCACAACCGCCTCCTGCGCGTAGTT
GTTGCCGCACAACGGCATCACTGCGGGCACGCCTTCGTGTACTCCCGTCTTCCTCGACACTTCCGCCACATGTCTGCTTCTGGATCAGCCTCAGGCCGCT
CCATGGGTGGCCAGGATCCCGGCGGGCATCGGGCACCATCGCCCTCGTCAGATCAATCACCGCCAACATCGCCTGATCAGCTGCGCCGCCAGGTACACGA
TCTCTCCGAGCGGGCGGCGTTACTGTCATCTCAGCTTCGCATCGCAAGGGAAGCTCGAGACACCGCCCTCCGTGGGGAGGAGCATGCACAGCGAACCCTC
GTACGTTCCACTCAGGATCTGCGGGCCTGTGAGCGAGTGTGCGATCGCCAGCAGGAGGAGATTGCTCGCCTCCAAGACGGTCGTTCACCTGCAGTCACGA
TCCGATCCGGGTGGTGACCAGCCAGATCCGATCTGCAATTTCGTCAGAGAGCGGATCGGCAGGCCGCCATAGTGTCTGATCTCGAGCGTGCTTCGCCACG
TTTCCCGTCAGCGAGATGGGTATCGCGGAGATTGCGATCGTCTGACTCGCGAGATGCGGCTGGCTGGCGACGAGGCTGAGACTGCTCAGGAGGACGTCAT
GAGGCCGAACTCGCTTTGGAACACGCCAACCACGAGTTGCGGGTATCCGGGATCTTCTGGAACGCCTACGCGATGATCTTCATGCCATCGAGAACGAGGC
GGCGATCCGGAGCGCTCAATTAGATCAAGCACGGGCTGCGGCTGCGGCAGGTGATTCCACCCACGGGGAGCTCCAGCGCCTCCGGGACGCGTTAGCGCGC
ACCGATTCGGACCGAGATCTCGCTCGATCCGAACTCGCCGTCGCTCTAGCCGACCGCGCGAAACTGGACGCTGATCTGGGTCAGAAAACGCAGGATCTTG
CCCGCCTACAGGGCGATGTCGCTTGAACGGTCACGTAACCGATCT