Description :
From Genome Similarity Track
Location :
contig_168:71- 1216
Transcript NameFunction/comments
g11677.t1hypothetical protein PHYSODRAFT_332764

Sequence
1145 bases(100 bases per row)
TTGCTTGTAATGGCGGACGTGTTCGTTGAGGTGACCAGACTTGTGCAGCTTGCGCATCGACTTCAAGACGTTTTGGGCCCCACGAGCTGTGATCTTGTGC
TCGCGGAGATACAACAGCAACTGTGTCTCCGCGCTGGCACCAACTTTCAGGATCTCGTCTCGATACCGCGGTGATTTCTTATCGAGCTCGAAGCCATCTC
GAAGAAACAGCTTCAAGAATGCGACGATCAACTTGGCGTTCGACCGCATGTGCTTGGTCGCTGCATCCGTTGAGCTCCACATCCGCGGTTCTTGAGCGTA
CCAAGAAAACCAAGCATCTTTCAGGTTGGTAGCAGCAGAGGTACGCCGACGCTTGGTTTGAGGATCGTTGTTGCTTATATCTTCATTTGAAATCATTGCT
GGCGGAGCTTGTTGTTGTTTGTTGTGTATCTTAGCCTCCACGATAGACAGACGAGTATCCAGCTTCTGGTTCACTTGAATTAATTGTTCAATCAAGGCTG
CTTGTTCAAGAAACATGGAGTGCTTTGTGATAGCTACCGTGGTGTCTTGGGTGGTTGTATGTTTTGCTTCAGATGTTGTCGTTGCGTTCGAGGACAGGAA
CGACGACCACGCCAGCAGATCGTTGACTGAGAAGCCTTTCTCAACTGCGCAAGCCTCGATGCGTTGAATCGCCAGTCCGTCAGTGCTGAGACTTTTCAAG
GACGGATAGTGCCGCAGCAGATACACCATGAAGGTGTCGATGACGCGCACGTTCACGTTGTACGGTGGCGACTCCAGCCCGGACGAAGCGTTGAAGAGTG
CTGCCGCTACGGACTGGATCTTGGACTGGGTATCGGAATCGAAGCAGTCCAGCGTCAGAAGGCGAACTCTTTGTTCGGGGTCACGGCCGCTCAAGACTCG
TGCAACCCCGTGGTCCTCGGCAGGAATGTTGAAGACGTACGAGAAGGCTTTGTTCGTCGCCGTCATGTTCCACGCTCCACGGTCGAAAATCCACTGTACG
CACATTCCAGCTCCATTTGCATGCTGAGCTCCGCCCCGCCGAAAGGAATGCGACGTCAGACGCTCGGCCACGCCAGCATTTTTGGCGACTCTGTCCAGAA
CGCGATTGATGTAGCTGTGGATCCCAGGTGCTGTATCGGCCGTCT