Description :
From Genome Similarity Track
Location :
contig_6:709904- 711297
Transcript NameFunction/comments
g1893.t1hypothetical protein PHYSODRAFT_475409

Sequence
1393 bases(100 bases per row)
GGCCGCCGCGCTCCAGATCAAGCCCAACCGAATCCTCTACACGAGCGTCCTTCTCTCCTTGCTGCAGCCATTCCAGAGCGGGTGGTCCACCTCGCAGCTC
AACCTGACCGACTACAACAACACGGACGAGTGCAATGCTCGCCCGGTTGTTCCCGGTACTTGCACGCTGTTCAGCGGCCACTCCAAGCTCGAATGGACTT
TCGCCGTGAACGCATGGATTTTCGGCGCCATGGTCGGCAGTTTGCTGTGCGGCTACTTTAGCGACATGCTTGGTCGCAAGAAGCTGCTCTTCTTCAACTG
CTTCTTCATGATCGGTGGCGCTGTCATCCAGGCATCCGTGTCCAATGTGTGGCCATTTGCCTTTGGCCGTGTAGTCTCCGGCATCGCCTCGGGTGCTGCC
ACGGGAACCATCGGTGCGTACGTCAACGAGCTGTCGCCACCGCACCTGCGTAGTCACCTGGGTCTTGGCCTGCAGATCTCCACCACCATCGGCATCCTGG
TGCCGGCTATCTGCTTCTTCTTCGCTGACAGCGGTGATGGATGGCGCTACCTGGCTGGTTTCCCCATTGTGTTGGCCGCCATCTACATGGTGCTATCGCC
TTCGCTGTCTGTCGAGAGTCCCGCGTGGCTGCTCATGAAGAACCGCCGCGAGGAAGCCAGGCAGGTCATCACCCGCCTGTACGGTGAAGAACACGTGGAA
ACGGCGCTGGGCTGGCTTGAGCCTAAAAAGCAGCTCGGCGAGGCCGAAGAGGGCTACTCCGTTGTGCCAACCGAGTCCGTGCTGTCGCCCAAGTACCGTA
CGCAGTTCCTTGCCGGCCTTCTGCTGTCCTGCACGCAGCAGCTCTCGGGTATTAACGCTGTGTTCTACTACTCGGGCAACATCTTCTCGGACGCTGGTAT
CGATGACTCGCGCATCGGAACGCTCATCATTGATTTCATCAACATTTGGCCGGCCTTCTTCACGGGCGTAATGGCCACGCGCTTCGGCAACCGCAACATG
ATCCTATGGGGCATTGCGGGCATGATTGTCATGTCCATCGGTATGACTGTCGCCTTCCTCGTGGACGTTTCAGCTCTCTCCATCGTCTTCACGGCGCTCT
ACGTGATTGTCTTCGGTGTGACCTTGGGTCCGCTCGTGTGGGTCATGACGGCTGACATCTTCCCGGACTCGATCCGTGCCAGCGCTTCGTCCATTTGCAT
CGGTGCCAACTGGCTCTGCAACCTCATCGTCGGTGTGGGTTACCCGTACCTGGCGGATGCCTTTGACGACTGGAGCTACACGCCCTTCACCGGCTTGCTC
ATCATCTTTTTCGTGCTGTCGCTGAAGTTGGTGCCGGAGACATCGGGTAAGACGAGCGAGGAGATCCAGGCCGAGTACGAGGAGCGCCGCCGC