Description :
From Genome Similarity Track
Location :
contig_7:70972- 73986
Transcript NameFunction/comments
g1995.t1hypothetical protein

Sequence
3014 bases(100 bases per row)
CGGAAGCTTGAACGGCGGTGTCAGCGGCCAGGGCGAGCTGACCGGCAGCCTGAACGGTGGCGTGAACGGAGGTGCCAATGGCGAGGTCAGCGGAAGCTTG
AACGGCGGTGTCAACGGCCAGGGCGAGCTAAATGTCGAGGGCAGCGCCTACCATGACGATGCTATTGATGGCGACACTGAAGGCAGTGCCTACGTGGAGG
TTGACGATGTGAATGAAGGTAGCGCGTACGATGAGGATGATGGGGAGACTGATGGCATCACGTACGAGCAGGGTGAGGAGGGGAACGATGACAGCGAGGG
TGAGGAAGACAGTGAAAGCAGTGCGTACGAGCAGATTAGTGAGCCCGAGCGCAGCGCGTACGGCGATGCCGCTCTTCAGTATGATGGGGAGATCAACGAC
AACGTACCGGTAGATGGTGACGACACTCTGCAGATCGGCGGTGATGTCGATACCGGTCTCAGCATCGGCGGCGACAACGGTCTTTCTCTCGGCGTCAACC
TTGGTGGCGGCCTCAATGTCGATGCCGGACTGTCTGCTGGCGTCGATGTCGGCCTCGGTGCCTTCCACGCTGGTCTCGGCGCCAACGCTGGCCTGAACAT
CGGTGGCGACACCGAGGTCTCTGCCGGCGCCGACTCCTACCGCCGCCGTCTGCGCAGCAACTAGAACATTCATTTCTTCATGAAGTAGTTGCGTTTACGT
GTTCAATATACACTTTTCATTTGTCCAACACCGTCTGTTGTATATATGTTGTATATATGAGGTGTAGCACACATTTTGTATTTGAACCAAAATGGAGGAG
TTCGACCGCGAGACGCCGCTGTTCGACCGGCGTTTCCACGTGCTGGTGCAGTACCCAGACCGGGACGAGAAGCTGTTGCCGCTCACTATCCGCCTGCTCA
CAGGCGTGCGCGTGCGTGTCTTCATCCGCTGCCCCCGCTTCCCTTCTTAGACACAATGCTAATTCTTATTTGGTCATTTGTGTATCAGCAAAATAATGCC
AAGAACCAGAAGGAGCGTGTGATGCGCGTGGAGATGACAGATGACGACGGTGTGGATCCGTACTTCCTGTACCTCTGGAGCGTCTCGGAGGAGGAGTTCC
ACGAGCTCAAGACGCAGCAGCGGCTGCTCGTGGACTTTGCCACGTTCCCCAGCAACCTCATTGAGCTGCTGCACTGCTGTCTCAAGGACAGCAAGAAAAT
TGCTGAAGAAGAAGAAGAAAAAGAGGACAAAGCCAGCGATTTTGGGGAGGAGGAGGCTGCCGTGACGAAGAAAAGCAATAGTGAGACGAAGCACAGTCAG
AAGGCGAGGTCGGCGGGACCAATTCCGTTGAGGTAGGGTGCTGAAGCAATTTGTGAGAGTTCTGTGAGGGATGGCTGATGCTTTTTGTGTGCGGTTTACA
GCTATTTGGCGGTGCTGAACACGTCGGATAGCAATGGGCAGTCGGTGTTTAGCATCGTGGAGACGAACCCGTTCAAGCAGTTGACGCATTTGTCGTTGAG
GTTTTTCCCGGGTGATGATGCGGCTATTAAAGCGTATCTTGCAGCGCGGTTGGCGCAGGTTGGAATGAGAAGGTTGTTGTCGACTTCGCTGAAGCAGACG
AGCGAGGAGCTACAGGGGACGCGGAAGAGTGAGACGAAGTTGCAGCAGCAGTTGTCGGCGTTAGGATACGATGCGGAGTCAACGCTTTCTCAGGAGAAGA
TGAAGTTTGCGGATGAATTGGATCGGCAACGCAGGACTGCTGCAATGAAAGCGAGGGAGGATGAACTCAATGCTAAAATTGACGCGCTAGTGGAGAGATA
CGAGAAAGAGGTAAGCCGCTTTTGCTTCAGGTTGTTCGCAGAGTTGTGTTGTAGCTGTAGACTAATACTTTGTGCCGAGTAGATTCGAACTTTGAAGGCG
GCAGCAGAAGCGAGTGAGGCGCAGGTGCAGGATCTGAGCAAGCTGAAGTACCAGCACGAAATGCAGATCGACACCTTCAAGCCCAATCACAGGATCTCAG
CCAAGGCAGAAGTACGCTCACAGAGGAAGTGGACGAGCTGCGCACTCAAAACAAACAGTTGGACCAGAAGGTATTCCAACAGGAAAAGCAGATTAACGCA
TTGCAGGTGCGTGCGGACGCGCTGCAGCAACAACTTGCGGACAAGGAGGACGTGATCAAGAAAAGCACAGACCTTCTCCAGTCGGCAAAACTCCATAACG
AGGAGGTCGATGAGTCATTGAAAATGTACCGTGACAACCACGCAAGGCTACAGCAAAAACTGGAGCTGAGCATTTCGGAGATCAATAAGGTGAGTGGGCT
ATGATTCTTACCAGGAGCAAGCAGCTTAGCTCAACCAGCCGTGCCGTGAATTGTGCAGGGAAACGAGATTATCGAGCGCATCCAAAACGAAAATCGCACA
CTGAAGTCGAAAATGCGGATGAAGGCCAAGATTATCAAGCAGCAAGAGCAGGTATGATGCCCTCATATTGATGCTGTCTCAGGCAGAACCCAGACTCTAA
CGAAACGGATCTACCATCAGTTTGTGGAGGAAAAACAGCTTCAGCGCGAGGAAGCGTTGCTGGAGCTGAAATCGACGAAGGAAGACATTCGCAAGCGGGA
CGAACACGTCGCACAATTGAAGGCAGGGACAACCGCATTTGCTCACGTGCATTGTGGCTCCACTCACGTGCTTTTGACTTATTCTGCAACAGGACACGAT
CAAGGAACTGAGCCAGAAATTGGAGGACAGCAACAAATTACTGGCATCCAACCAGCAAGGTATAGTTGTAGCGTGTAGTTCTGTTTCCTTTGGGTTTGTT
CTAACCTGAACCTGATGCGCTGTGAACAGTGATCACATGGCTGAACAAAGAGATCAATGAAGCACAGCTCGGCCACCAGCGGAGGTCGACTGCACACCCT
TCCGTGCTCGCGTTCCGTCCGACGGATAAGGTGATAGCCGCAAAAGTCATGACGAACCAACCTCGTCACAGCAACTAACCTCCTGTTTGATATGCACGTA
TTATCTCGCAGAAG