Description :
From Genome Similarity Track
Location :
Scaffold_1:709609- 737327
Transcript NameFunction/comments
Phyra_72786fat-free family protein
Phyra_727873'5'-cyclic nucleotide phosphodiesterase, putative
Phyra_93348ATP-dependent RNA helicase dbp4, putative
Phyra_72790PREDICTED: DENN domain-containing protein 5A-like
Phyra_93352Rab32 family GTPase, putative
Phyra_93353ubiquitin-conjugating enzyme E2, putative
Phyra_72794syntaxin 7-like protein

Sequence
27718 bases(100 bases per row)
GGCCGCCATGGAGGACCCCGGCATGAGCCGCATGCAGGAGCTGCTGAGCAGCTACTACGGGCTGCAAGACCAGGAGAGCAGGCAGGGGCAGCTGCGCAAC
ATCGACTCGCCAGGATTTGACCCCAAGATCTATGTCAAGGTGCGCAACAGCGTCCTGGAAGACAGCGTATATCCCTTCGTGTAATCCCAGCGTAACCTGC
TGCTACTTTAGGAGCTGCTGGAGACCCGTGGACTCAATGACCTGCTCACGACGGACGACCAACTGATCCGGGAGATTAAGGAGCTGGACACCAACATGCA
GATGCTCGTGTACGAGAACTACAACAAGTTCATCAGTGCCACAGACACGATCCGGAAGATGAAGGTACAATTTTAGGGTACAGTGCTGTCCAAGTTTTAG
TTTTGACAAAGTTTGTGGGTTCTTTGTTGATGTAGAACAATGTGGCAAGCATGGAGGACGAGGTGGGGCGAGTAGTGAAGAGCATGGACACGATCACGGC
CAAGAGCGAGAGTATCAATGTGGCACTGGCACCACATCGCTCGAAAGTGGAAAAGCTCATTGGCGTGCGACGTCTGTTGAAGAGATTCGAGTTCATTTTT
GACCTGCCTCAGAGACTCAACACGTACGTGGGGGGAGGTGGTCTGTTGGGGTAGTGTTCGGGCTGGGGAAGGCTGAGTGTTGGTTTGTTGTGGATGCAGT
GCTGTGAAGCAGAAGGAGTATGCCAATGCGACCAAGTACTATCTACTTGCACGCCGAATTTTGGGCAGATATGAGCATATTTCGTCGTTCAAAGTGGGTT
TGGCTGTGATGTTTGCTGGTCTTCCACCACTAGCTGACTTTGTTTGCCGTAGACGATTCAATTGGAGGCCGAGAAAATTATACAGCAACTTGAACGGCTG
CTCAAGAAACGAATGCTGGACACGACGCTAGAATCGGAAGAGGTAACGTTATGCAATGCTTGTCGGCGCATTGCACATCTGCTGATGTTGCTTATGGGGG
ACAGGTCTGCGAGACAGTGGTGCTATTGCACCAACTAGATGCATGCAACGAAGATATCCGTGACCAGTTTCTTGAGTGGCACCAGGCATACTTTGAGTGC
GCGGTGGCAGAGTTTAAGGTACACATAACTATCGGGCTTCGGGTTTCATGTTCTAACATGCGCACCAATTATCTGCACTGCAGTCTCAAGGCACTGTCGA
CTCGGTGCTCAACTTTCTGCAGAGTTTTAACACCGACGTATTTGCGAAGATGGGTCGGGTGTTCTCGGTGTACAAAACACACTTCATGCCTGACGTCGTC
GCACGCGAGAAATCGTCGACATCTCGAAAGTCCTCTGATGCCATTCGTGACGACTTGTTCCTCAGTTTTGTGAAAGAACTGTTTGCACTGTACCTGAGCG
AATGCGTTGCACAATTCCGTCGTCCTCACACTGAATTTGTAAGTTTCTTGCTTCAATATGAGCGCCTTTTAACTATTCGCTGTACAATTTGCTACGCTTC
GTACTAACGATTGCTCGAACCTTGTTCTTTTTTGCAGGGATCAACAGATGAGGTTCTTGACGTGCTGCAGGACGATGACCTCTCATCCGAAATCGTCGAT
AGTGAGTACTTTGTTTTCATGCAAGTGATGAAATACTTTGTCTCGCAAGTGAAGGCTGTGGACACAAGCATCCCAATGTGCAGACTGGCCACAAGTGCCA
CCGAAGTTGTTGAAAACTGCGTGCGCTTCCAGATTGAGGGTGTCTTTCGAAAACTCCGCGAGGATACTGGAGAACTCTTTTGCACCTCTCACGAAGATGT
GTCGAGTCTGGTGCGCAGCTCACGCGATGGCGGACAGAACATTCAACCCCTAGCACAAGAATCAGCAAAGAAGTTCACTGACATGATGCAGAAGGTGCTG
CAGCAAATGGAGCCCATGGTGCAAACAGGCTTTGCGATTCTCTCTGAAATGAGCCGACTTTTCTCTGACTTAGTCCAGGTAAGCCATACTCTGTTTTTTA
CTGACGCTACTAAACGATTCTGAGCCTATCGTGTGCTGATCGCTGTCATACGCACGCTTGTCTTGTTCAGGGCCAATTTTACGATTTTCTGAAGTGGTTC
AATGCGTCCGTGCTTCGGTATGCTGAACCTAAGCGCGCATTTACCCCAGCGGATGACCCACAAGGGACACGGGGTGAAGAGCAAGACGGTGTAACGCTTC
CGTGGTTGGAACCCACTCCTCAGTTTTTGCTGTTCCTTGCTTGCATGTGCCAAGAGCTGTCTGCTGAAGGCATTGGTGAATGCGTGCGCGGCCTCATAGA
GTGCTTGCCAGCACCCCTCTCTCCTTCGAGAACCTCCGAGGGGGAACCGATTCGTAGTCGCCGAATGAACCAACAGGATGTGACGCACATGATTGAAGTG
ACACGCGAGTCTTCTGCAGAGCTGCTGCAGCACGTCGCAAAGCAGTACGGAAACCAGTTATGCATCATTGTTCATAACGGGGTGGCTGCTACATCCTGGG
CTGATATGGATGAGGAACCAAGAAGCGTTCAAGAGATGATGGCTGCCGTTGTAGAGGCTACTTTCCGCTTCGGAAAAGAAGTAGCGCTTGCGCTCGGCGA
TGAACAAAGTGTGTTTATTGGAAACAACAGTCGTACTACAAGCCGTGACTTCCGCCGACGTGCCAGTGCGCTGCGATCTCGCAATGCAGGAGTTGCTGGA
GCATCGTCGGGTATGCAGCTAGATGTGGATCGCATCTTCGCACGCAAAATCCACATCTCCCCGTCCCAGGTAGAGCTTACGGCGGACGCTTTCGTCCAGA
CCATGCTCAAAATGTGCATTAAAGCTTTCAGCGAGTGGGTGAGGTTGCTGGAACTGTCAAAGTTTGGGCTACAACAGATTCAGCTGGATGCCGAATTTTT
GCGCAGCACACTGATGCATATTGTGGTAGCTGGAGGAGCAGAGGAAGAAGTGGAGAGTTTGCTGTCCGATCTGCTTTCGAATGCTCGCGCTCGTGCCGTT
GAGGACGTTCTGATGGAGCAGAGCAACGTTGTTGCCATCGTGAGCACGAAGAGTACGCAAGTGTTGTCCCGCCGAGGCTGATTAGGCGGATGGTTTCAAG
AAGGAAAGAAAGCAAGATCGTTGTGGGCCTCAATATGTTCATTTGTATCTGTTCTCTCCTTTGCTAGCAGTATACGTTGCTCTAACGGGTTGGATGGCCA
GTGTCATTTTTTGTGATCAGATAGACGTCTCGTGCTGGGAGCACGCTCCACAAGGTTGCGCGAGCTGGAGCCACGTACATAAACTCTTGCCAGCTCTGCA
ATTTCCTCTGCCTCTCGCTGGAGTTTGTCCAGTTCAGCCTTGTAGCGCTCTCGGTTGGCCTCCAACGAGTCCGCGTAAACCCGTACCGCAGGGCACAGAG
TGGCCAGAGGCAACCAAATGGGTCGCAGGACATAGTTGATGAAGTTGAGTTGCACGGTGACCCGGGTCTTCGCGTGGTGCAAATTGGTCATGAAGGAATC
TACAGGAACGTGCATCTCGGCTTCATTCTTCGCTTGCTGCTGAAATTCGGAGAGCACGCGCATGCCCCAGCGAACGGCTTGTGTGTATGGTAAAGCCTGA
CCCGACAGGTCTGCTGCATGGATGAGAATGGCCATGAAAACAAAGCGATGCTTGCTCCGACTTCGCTTCGACCCTCTGGCCCCGCTGCTGTTAACAAGAA
GGTGGCGCTTGGAAAGCCCTTCCAGTGCCTTGCACTTTTCGAAGTGTTTTGCCATATCCGTCGCCAGAATGCAGTGGATGAGAAGCCGCCGCACGTATAC
GAAGCAAGCGCGCGAGGGTAATCGTGCAAGAAGGTTTGCACCTGGGTGGCTCAAGATGATGAATGCTACGCGACAGTGGTGCCGTTCCAGAACGGCGTCG
TCATTGTGCGTAAGAGCGAGCTGGCTCTGCGCTTTTACCTCGAAGTCGTTCGTGTTGCCAGGGTGATCCAAGTCGTGGCACAATGCAGCCACGAGCATGG
CAAAGACTTCGACCCGTGCGAAATATGATTGTGCTACACCAGAGCGACGCAGCAGACAGTATGTTGCATGTGTAACCTGGAAGGCGTGCTGGAGATTGTG
GAAAGCGTTGGAGCGATAATGAGATGCTACGTGCGAGAGGAAGGTGGAGAAGGTCTCCTGCGCCACCTGAAAGCGCTCTAACAAACCAAGTGAACGGAAC
AGCACCGATGTTGCCGCGAATATATCCGAGTTGGACAGGTCCAGACAGCTAAAGTCCCAGCGAGTTATATCGCCAACACCTATCACATGTCCATTTTCGC
GCGCAGTTGAGATTCGTCGTTGCGGTATACGCTGGGGAAACGGAATGGCAGCGAATGATGTTGAATGCTCTTCTTTCGCGTTGGAATCGTCATCGTCGTC
ATTATAATCACCGCCATTCGCCTCGTCCGCGTCTTCGACGTCGTCGGGGTCGTCAGCAATAGCTGCAATTGCTACCTCGTCCAGGGCGTCCAAGTCGCTA
GATTGGCAGAACTTCTGCACGATGGATGAAATTATCTCGGGCTCATTCACATCGTCTATGACCGGGTCCTGCGTTTTGGAGGCATTGGGGGACTCGGCCA
ACGACTCACCAAGCCCACAATCCGACACCACTTTGTAGTATGAAATGTCAAGCGACAATCGACCGAGCGCGAATTGAATTTCCCGGCAGTACTGAGCCAT
GCAATCGGCATCACTGGTGGTGAAAGGCACCCGATGTCTGGGAAGATGGTGACATTCATCGCCATCTACTCTCACGTTGGTTGCTCCGTCGTCGTGATCG
TCTTTCTTGTTGATTGCCATTACAACCGCCACGATTTTGGGGTTGACCGGTGTGTGATCCTCGAACACAGGCATGCCCAGCACCGTTGTGGTGCGGTATC
CCGTTTTGCGGTCCAGCGTGGGGTTGAAGTGCGGGTGCGTGTAGGCGTCACGCGTGCAAATTGTCTTCCCCGTTGTTGCGATCCGTCCAGAGAGACCATT
GGTGAGCGGCATTCGCACGCTCTCTCCGTCTTCCTGGGTGATCCATAGCTCCTTCTTCAGCGGGTCCACCAGCAAGAAGCCCAATCGGTCGCAGTGCAAT
AATTTCTTGCCTTCAACCATGACGACACGCACGAACCTTGCGACTGAGGCAGCGGCGCTAGTCTCGTCATTGAATCCGTGATCGGGACTGGTATACGCAC
GTTCACCGTTGCTGTTTACAAAATCGGCGAGCTGTAGTCGCGCTTCGGTCAGGCGCTGTGACATCAGCACGGAACGAAGCAGGTTGGACTTGTGCAGCGA
TATCCCTGCGGCCTCTGCTGCGTAGTTGAGATAAAGTGCGTCGTCCGCGGTAAACTCATCACCGTCGACCTTGTTGGTGGCGCAGACAACTGCCAAGACT
TGGCCTCTCGCATCTTTGACCGGCGCGCAGAGCACTTGCTTCGTCTTCAGTGACGACCATAAGGCGTCGAAGCTCGGATCAAACGCTGGGTGGCTTGGTG
CCGAGTTGGAAAGCACAAGTTGTCCTGTTCGCATAACCACACCAACGATACCATTGTGCGCTTTCAAGAGAACGTCGTCGTACCCACCGCCATGTCGAAG
ACGTTCGTTAGAGTGACGAGGTGTGTTGCTCGCTTTCGCTTTTGCTCTGCTTTTGCTCAAAGTACTGGCCCTATCATCCTTGTAATCGCTGACGAAGAGA
TAGAACTCATCCGCACCTTCGTCGCGCACGTAAAGCGCAATGTGTTCGGCATGCAGCAGCTCATAAGACACTGCGATAATTTGGTGTAGCACGGCCGACG
CGCTGATCTCAGCTGCGATGTTTCGGTTGAGTTTGAGGAGACATTCGATGCGACCTTGCATGACCTGGTGAGCTTTCGCGAGGGACAAGTTCCACAATGC
TGTGCCCGCAGTGACGCAGATGTAGTCGAAGCTCTCTTTGTCGCGATGGTCGAAGGCTCCCTGTTGATGAGCTTCCTGATTGCGCCCAAGCTTGGCCAAG
GCAGCACGAGGGGTAGTTGAAAACCAGAGAGGTTCCACTACGGGAGCTGGAGCAGCCAGGAGACCAAGCTCGAGGATCTGCTTGCGAGTGATGACTTGAA
AGACGCCGACTAGTACTCCATGGACATTAAAAATCGGCGCGCAGAGCAACGCCTCAGGCTCGAACTCCAGGAGCTCCATTTGCTCCTCAAACACATCGAC
GACCTCCGAACCACTGACATCCGCGACTTCAAGAGGTGTTCCAGTCTGGATCCACAGCAATTGACAAACATGGTTAGGCAAAGACACCGCGCACGATGAA
CAAATGCAGCGGAGTTTACCAGTACAACGCGGCCGAACGTCGTGGCAGAATCGACGAGGACACTGCCTTCCTCGGTAAGGTAGCGTTTGCTAGGCAAGTC
CATTGGTGGGTTCGAGTAAAGCTCGACGCGGTCTTTCTTTTCGTTGAGGATGCCTACGGTGTACTTTTCTGCTGGAAGCACGTGCTGCGCAGCACGAAGC
GCGTTGCTTACGATGTCCAGGCTGTCGGACGCTTGTGATATTTCGCGCATGGCATCCATGAGCGCGCGGAGCTGAGGACACGTCCAGCGGTCGTAAGTGA
CACAGCACTTGACAACAGGATTTCGCACGGCAGCGAATACGTACGTTCTCTTCTCGCTCTGTAAGCTGGTTGAGTGTCTCGGCCTGCTCTCCGATGAGGT
TGCGCATACTGGCCCCGAACATCTCGCTTTTGGGTCGAGGGCGCTTGGGCGTCGCAGGATTGAACAAGTCGCCGGGTCGATACGGGCGATGCTCCGAGCG
CACCCCCGTGCAGCAGTCCAGCTGGTGTTGCCGCTTGAGTAACTTGAGCTCGAGCTCCCTGGCCTCTTCCTCCGACAGCGCGAGCTCCGCAGCCAGTCGT
CGATTCTCATCTAGTACTGTCTGAGCCCCGTGCATGGCCGTCTTGAGCGCTTGCACGGGCACATGCACCAGCTTGACTTCGTCGTCGTCCGCCATCGCTC
AGCCTGAAAGCAACCCAAGCCTAGAAAAGGGCAATAACCGCTTCGACACTCCAAGTGTCTCGTCACATTTGCTCATAAGTCACTATCTACCATTAACCGT
TATTTAACCAAACGTGCTATTGCACTCCAGCCATTCGCGTAGAACTCCACAAAGGTCAACGTCCACCGACTTGCATGGCTTCACGGGCGTTCCGACAGGC
GCACAGCCGGCCGCACGCCGCACTCGTGCAGGACGAAGACGCCGCCGCGGATGCCAAGCTCAAGCAGAACGAACGTGAGCGCCAGGAGATCGAACGGCTG
AATGCGCGCATCGCGGAACAGACGCCCGCTCGCGGTTCGCAGCTCGGCGATGCCGCGAGTTTCGATCTGTTTGCACTGTCGGAGGCTTCGCGTCGCGGCC
TGCGCACCTGCGGCTTCACGGCGCCCACTAAGATCCAAGTGGGTGCGCTGCCGCACGCGCTGGCGGGGCGCGACGTGCTCGCGGCGGCCAAAACTGGCTC
TGGCAAGACGCTGGCCTTCCTGCTGCCGGTGCTGGAGAAGCTCTTTCGCCTCCGCTGGGGCGTGGAGGACGGACTGGGCGCGCTCGTCATCTCGCCCACT
CGCGAGCTGGCGCTGCAGATCTTCGAGGTGCTGCGCAATGTCGGCAAGGCCCACGCGTTCTCGGCCGGGCTCGTCATTGGCGGGAAGAACTTCCGCGAGG
AGCAGCTGCGGCTCATCCGCATGAACCTTCTCATCTGCACGCCCGGAAGACTGTTACAGCATATGGAGCAGACGCCGGCGTTCGATGCGAGCAACTTGCA
GGTGCTGGTGCTGGATGAAGCTGACAGAATTTTGGACTTGGGGTTCCACAAACAGTTGACGTCCATTCTTGAGCACTTGCCGCCGGCTGGAGAACGCCAG
ACGATGCTGTTCTCAGCTACGCAGACCAAGTCCGTGAAGGATCTGGCGGCGCTGAGTCTGCGCGAGCCTGAGTACGTTGCGGTGCACGAGCATTCGGCCA
ATGCGACGCCCAAGGGTCTGTCGCAGAGCTACGTCGAGACTCCGCTAGAGCGCAAGCTGGACGTGCTGCTGTCGTTCATCAAGTCGCACCTCAAGCAGAA
GACGATTGTGTTTCTGTCCACGTGCCGTCAGGTGCGCTTTGTGCACAGCGTGTTCTGCAAACTGCAGCCGGGCGTCCCGCTTTGCGCACTGCACGGCAAG
TACAAGCAAGGCAAGCGCGTGGAGGTGTACTACGAGTTTTTGAACAAACCCGCGGCGGTGCTGTTTGCTACGGATATTGCTGCTCGCGGTCTGGACTTCC
CTCAGGTCGACTGGGTGTTGCAGCTGGACTGCCCTGAAGACGCCGCGAACTACATCCATCGTGTCGGTCGTACGGCACGTTACAACAAGCAGGGTAAGGC
GTTGATGTGTCTTCTCCCGTCTGAGGTGGAAGGCATGACGAAGCGCCTCGAGGACGCCAAGGTGCCTATCCGCGAGACGAAGCTGAACCCCACCAAGACG
ACAAGCTGCCGTCAGAAGGTGGCATCCGTTGTGGCCGGTGATAAGGAGATTAAGGCGCTGGCGCAGAAGGCTTTCATGTCTTACGTGCGCTCTGTGTATC
TGCAGCCGGATCGCGATGTGTTTGATGCCTCTGCACTGCCGCTGGATGAGTTCGCCGAGTCACTGGGACTTCCTGGTGCACCGCGCATGCCGTTCTTGTC
CAAGATGAAAGCTGAGCACGACAAGGGTGGCAACGATGCGCTGCGTGAGGAGCTGCGCGGAAAGAAGAACGTCAACCGTAAGCTGCAGCAGCTCAAGGAG
AAGATTAAGGCGGAGAAGGAGCGCAAGCGCTTGGCGCGCCAGCTGGCTGCTCTGGGTCCCAAGGAGCAGGAAGCAGCGAAGAAGAAGCTCGAAAAGAAGC
AGCAGCAGAAGGAGGAGTCTGAGGACGATGCGGAGGAGGACGAAGACTCGCTCATGGTGGTGAAGCGTGTACACAACTGGGACGAAGACGACGAGCCGGT
TGATTTGGAAGCGCTTGGACCTAGCAAGAAGAAGCAGAAGAAGCTGCGTGTGGACCGCGAAGCTATCAACGCTTCCAAGATCGTGTTCGACGAGGAGGGC
AACAGCGCCAAGATGGCGGACCGTCTTTCGGCGCGCAACACCGGCGACGCTGAGTTCGCTGACGTGGAGCAGCACGCCAAGCAGTACACGGAGCAGGTGG
CAGCGCGTCTCGCCGCCAAGGACGACGAGGATCGTCGTCTGGAGAAGGACCGTGTGCGTGCTAAGCACCACAAGAAGCGCATGAAGGTCAAGGGCGAGCG
CGACGACGACAGCGAGGACGAAGGCGCGCGCCTTGCCGTGGATTCCGACGACGACGAGGACATGAGCGGCAGTGGTGAGAGCGGCAGCGACGACGAGAGC
AGCAGCAGCGAAGACGAAGAGCAGGACTCCAAGAGGAAGGTGGTGGACCACAACGCCGTCGCCAGCCAGGAAGAGATGGCGCTGCGCATGCTGCAGCGTC
GGTAGATGCCTAGATATCCAACTAAACCGCTTGATCATACACACCACCATAGATGCCATCACCATCAAACGCATCGATATTAGAGCCCGTGCACCACGGA
AGTGGGACCAGCCCATCTTTTTTCTGGTTGGTCTCACCATTTAAGAGCGTCCCAAGTCGCCGTCCTTGCATCATGACGGACGCCACTTGTCCTTCCGTAC
ACCCGCTGCGTCGTCTTCCCAGCGGAATGCGCGTGCCAGCGTCGTCCGCCCGCCCGCGACGTCGCCGCGTGCGTGCAGTTGCCATGATCCTGGACGACGT
CCTGTACGACCACTCGGGTCTACTCTCGCACTTGGCCATCGACCGCGGCGTGGCCCAATTGCTCGACGAAGGCGCGTTCCCGACCAACGCAGCGGCCTTC
GAGGCCCTGCAGACCTTCCGCGACGCCTACGGATTGCGTAAGCGCTTCCCGCGCTTCGTCGACAGCCTCGTGGGCGGCTCTCAAGCCAAGCTCTCGCCCG
CTCAAGCGCAGCGCGTCATTGCTGCTTACTACGAGAGCAATGTGCCCGAGGCTCGAGGCATCAAACCCTTCGCGGGCGTGCGCAAGACGCTATTGGAGCT
GCAGGACGGAGGAGCCTGCCACTTGGCGCTGCTGCTCATTGGCAAGCCAGAAGTGCAGCGAGAACGACTCAAAGCTCTGGGGGTGGACGACCTGTTTGAC
CAAGTGGTGCACGTGAGTCCCAACCCGAGCTTGGCACAGGTGACGAGCGCCATGAAGCAGCTGACGAGGCAACTGGAGGTGCCGTCGTCGGCAGTCATGT
TCGTGGGGCGCAAGGCCTTCTACGAGATCAAGGCTGCAAACACGGTGGGCATGCTCACCGTCCGCATGGTGCGTGCTTGGAGGCAAGAGAGAGAGAGAGA
GAGAGAGAGAGTCTTGTGCTGGATAGTTTATTGATGTTGCAATGTGCTGTGTCTGTAGCTGTTCGGCAAGTACACGAGCGTCATGCCTACGAACGAGATG
GAGCAGCCGAACTTCCAGGCAAAGTTTGCTTGTGCTGGTTATTTGTTGTTTGCGTCGCTGACGTTTATGCTGTCGTGGCGATAGATCGAGTCGATCGAGC
AGCTCGTGCCAATTGTGAAGTTGGCAGACCAGCAAATGCTGCAGCCCAAGATCGTAGCTATTGGCGGCGGCACGGGTTTGGCTGTGCTGCTTAAGGAACT
GCGTCACTACCCGGCCGATCTTACAGCCGTTGTCACAGGTACGCTAACGACACGCTCACTCAATGAATCTTTGCTACACCTGCTTGCACTTAAAGTGCTA
TGACTAACTCGATGGCGTTTTACCTGCTTCCCTTTTACGTAGTGTTCGATTCGGGTCGCCACTCTGGTGCTCTTCGCAAGTACCTGGGTATCTTGCCTCC
TGGAGACATTCGCAACTGCCTCGTGGCGCTATCTGACTCCGGTGAGTGTCACTCTAATTTCGCAATGCCTATGCTAATCCATTTGTGTGCACATGCGCAG
ATGAACTCTTGAGCAAGCTGATGAACTACCGCTTCCGCGAAAACTTCATGGAGGGCTGCAGTCTCGGTAACTTGCTGTTGGCAGCACTCACGGACTTGCA
GGGTGGATTCGATCGCGCCATCTCGTCCATTGCTGACATTCTAAACATTCACGGTTCCGTGCTACCGGCCACACTCGAGAGTACTGAGCTGTGTGCTGAG
CTGACAGACGGCTCCACGGTTGTCTCGGAAGTCAACGTGCGTAGTCCCTTCGTGCCGAACGAAGAAGACGAGCCTCGATCAGGTTCCGATTCCGCTACGA
GCAGCACGAGTGGAACCCCACCAGGAACCCCGCCAAAGCCCGAAGACCAGAAGATGAGGATCAAGAAAGCGCCGATCGAGCGTGTCTACCTCGAGAACTC
GAACGTGGAAGCCTTCCAGCCGGCGGTGCGTGCCATCGAGGATGCTGACATCATCATCCTGAGCCCCGGCGGATTTTATACTTCCATCATCGCCACACTG
TTGGTACCCGGCATTCGCGATGCCATTGCTCGCAGCGCGGGTGCTACCGTTTACGTGAGCAACGTGACCACGCAAAATGGCCAGACCGATGGCTATACAC
TCGAGAAAACGCTGGAGGTGCTGTCCACTTATCTAGGCGCAAACGCAATCGACTACGTGATTGCCAACAACACATACCCACCTGAAGACGTCCTTGCGCC
GTACGTGGAGCGTGGCGAACAGCTTTTGCTGCCTACTCCCGAAATGGTGGCAAGTGAGCACCCAGTGCTGCTTCAAGGCCAAACTTTCCAAGAAGACCTT
GTAGCTGGCCATGTGGCGCGCGAGTGGAAGAAGGCACCTATGCTCAAGCACAGCGGCCGACGCGTAGCTGCTATTCTCTACACCATCATCGACAAGGAGA
TGGCACGCCATCGCCAGCACCTACAACCGCAAACTGTTTCCAAGGCAACCTCAGTTAAGTTGAAGGAGTCGAAGCGTCCATGGTTGTCGGCCTTCGCGGC
CCCAGTTGCGGTATTTGGATTGCTTGCGGCCACCACGTTGCTGGCATCCGTCCTTCGTCGCTAGCTAAGCCAGAGTACACCAAAGAAAATAGGCATGTCA
CGAGAAACACTAAATATCAAGTTGGTTAAGCTCAAGAACGCGAACGTCACGCACATTAATTCTTCATCCTCCACACTGAGGTCCTATTCACACATACATT
GAAGCATTGCTCCAAGAGTAAAAGCTCAGCCTTCGCAGCTGATAGTACGACCGGCTTATTTCCGCGGCAAGGACGATACAGAGGACGACGACATTGAAGC
AGAGGGCGAAGAGGTCGATGATGGTGCCGTGGCGCCGTTAGATTGACCTGGCTGCTCCTCGAAGCCGTGATGTGTGACCATAAATTCCGAAAAGGCCTGG
CTGGCAATAAACAACGTCCGGAACTCACGCATCTCGGGCGAGGAAGCTGCAAGGTAGCTGGCCTCGTCGAAGAAGACAGTGCGCTTTCGTGCAAATTCGT
CCGTCCAAACGTAGCGGTGGTACCCGAAGTTGCCGATAAGCTTGTTGACAGCTCGCAAAAAGAGTCCACGCACGGCGACCTCCGGGAAAACTAGCGGCTT
GCTCGGGAAATGGTGCGCAAATACGTGGTCGCTGCGGCTCACATTAGGCTTGAGGCACTCGTAAAGAGCGTCGCGCAAATCGAATCGAACACTGTCAGGT
AGCGCGCACGGTACTTCTCCACGTAGAACCGCCCCCTTGTCTAAGTCCACAACCAACAGCTCCTCTCCAGCTCCTGCGAATAGGTCATCTCCGCCTTCTT
CGATAAGTTGGCGCTGGGCGTCGTCCAGCGCTTGCCTTTCAGCTCCAAAAATGAAGGGCGTGGGGCATTCCAAGTACTGCAGCATTCGACGGGGCAGCAC
AGGTAGGTATACGTGTGGCCAGGACAGCGGGTGCATAAGCGCTCGGAGAGACTCGCTAACCTTCATGAGCACCGAGAGATATGACGACACCAGTAGAATA
CGATTTTCCAGCAATGCTGCGGTAAACACAAGAAGCACGGTGGACACATCCAGAGTATCGAAAAGAAGGCGGACGGAGTGGTCCAGACGTGGAAGCGCCG
CAAGCAAGGATACTGCGGTGGCTTTTGGAGTTAGACTTGATGCTTCAAGCAATGGCGATTCTGGCAGTGGTGACGGCTGGTGATACTGCGAAATATGCTC
TTTAGAGACGGCACGGGTCAACTTGGCAAGGACCTTTTTGTCGAGCTGAAAACCCTGCCCACCATTGTGTAGAATTCCCTTGTCGTCGCCGTTGGCAGCA
GCTGCGGCAGAGATGGTTTCAAGCTCAAGAATGAACTCGTATGCTTCCGCTAGACGCTCTCGCAAAAGATCCACCAGTGGAAGCTTAGATAGGACGCACA
CACCGTAAGGCACCCATCGACATCCAGCTGCAGAGTCTATCCGGGAAGACTCGAGCGCGCGCCGCGACAGTGGGGGCGCTGGTTTATAAAACACAATACA
AGCCGCAAAAAGTTCGGCTGCAGAGGCACCAGCACTGCTATCGCCCATGCGAAAGTTAAAGGCAAAAGGTGCTGGACAGCTCGGTGCTGTGAGTACCACG
TGCCTAGGATCAGCGCTCCAAGGTACGAGAAAGTTCTCGATAGATTTGTCCACATTGTGTGATGTCGGGTCATGAGGCAGTGGATGTTGAACAACTCGCA
GTTCGATCGGGTCATTGAACGGCACGCTGCCGTCTTCCTCACCATTTTCTGCTTCTTCGGCTGTAATAGGAACGGGAACTGCTTCAAATGTAAGCACGCC
AGAGACCGCTTCAAAACTTCGCGTTGTACGGAGTGAATCCAGAGTCTTCTTCTTTGGCGCTGCGGAATCTCCATCACGCGAGCTCGATGAAGAAGAAGTA
GACCCACTAGACGATGAGGAACCATTATTTCCTCCAGTCCAGTGATGCGCACGCAACCCGTAGCTCAAAAGCAGCGCCGAGAGTCGCATGGAGTCATCAA
TGGAGTCCTTCTCATCCTCAGCGGAAAGTTTTGGATACAGAGCAAATTCTGCATAGGCGCGGCTCGTTAGAAAGCGATGATAAAGCTCCAGGTGGATGAG
ACTGAACTTCGTCAAAATGGCATCCTGCTCCGCTTGAAGTCGGGCACACGATGTCACCAGCGTGCGGGACAATGTCTGCATCTCACGATCCCCGGCGTAG
TACTTCTGCGAAATGTACTTGAGCAACCTTCTGCAGCGATAAGCAGCCTGCTCTATACGCTCGCGACGGTGGTTGATACTTGTGCTGCTCGATGCTGAGG
CGCTTCGGGAGCTGCTGCCGCTGGACTTGAGCAATGACATGTAAATGCGGAATGCAGGCTTGAACTCGTACTCGACGTCCAACCACAGCGCTATCTCGCG
ATGGTAATTGTGCGGAAAAAGGAAGATCCAGAAGAAGTTCGCAAAGCGGTGGTTCATCAGGATGTCCTCGAGGCAGATCACTTCACGCTCCACAGTCTTC
TGCATTTCAGTATACAAATCCGTTTTGCGAAATTCAGGAAACTTCATCATCAGCACACGTTTCACCTTAACAGCGACATCGTCGAAAGTACGCAATGCAT
CTTCACCCCCAGCAGCGAGATCACGTTTGATAGTACGTATGTTGTTTGAGTCTACAATAGGAGGCTCCACATTCCCACCTTCAGCTTCAGTAGCATCGAT
CAGCCCATTTATTGGAAACTGCGCGTTTTTCGCGAGGTATTTCATCGCGATCTTGACGCCGTAGGTACGTAACATGAGTACATCATCCTTCGCGAAAGGT
TTCTTCTGGTAGTTGGCGCGTAAAGTACACCAAAACTGACGGTACTCTTCAAATGAGCAGAGGAAAAACAATTTGCTCTGGTCAGCAGGGTCGGGGAGCC
AGGCAGCGTAGTAGCGCATCATGCGCGGGTTGCTTATCACTTCCTCGATTGAAATAAGCGTAGTCGGGTTTGGAGTAGGTTGGTGTGGCGGGAACGCAAA
TTGCTGTTGCTGGCGCTGAAAAACCTCGTCCTTGAAGGCCCGTTGCATCACCTTGCCGAAATTGTGCTGATATTGATCATGCATCCATCTATTCCACTTC
TGAAACTTGGCGCCGCCATTTGACGCAGGACCGAAGGATGGCAATGGGGGCAGCAGCGAATGGTGTGTTGATGATGAAGATGCAGCTGACGACGCACCTG
ACATAACACCAAACCCACTGCCGCTGCTCATTTGCGATAAAATTTGCTTCTGTTTGTTTGCCCAAATCTCCGCCGCTGTCGGTGTAGCAGACGTCATTTC
GCCGCTGTTGCTGGCATCGCTAGCAGCGGAAGCGCCGTTTCTGTTCCCTGATACTGTGGAATAAAGGAAGCTCCGAGCCTTAAGCTTAACGTGTTGTGCC
CATCGAGACTTGGCGTTCTCAAGCTTGACATCCTCCTCCTCCTCCTTTATACTAGTGACTTCGTACCCAGTCACATCTTCATCCGATCCGCTTAGCACCT
CCGACAGCTCACGTGCGCTCAGTTCACGTTCCGGTTCAAATAGATCTGTCTCATAGAGCATCTGCTCCGATATTGTACTTCTTCGGAACGTGCTGCGACT
CGAAAACGAGAACGCTAAACTGTCCCGCGAATGCCTCGACATGGCCAACGAGTCTCGTTCGTTTGCCACCCCCAAATTGCCACCCACAGCAGTTGATCGT
CGTTGGTGCGGCAATAAAAACTCATCCTTGTCTGTATACAGCGACGAGCTCAGAGCACTCGCCATACTTTCTCGAATCACCTCCTCCGCCGATATCGTAC
TGTCCGGCGGCAACGGCGGACTTGAATCCAACGAAGCTATCAGCAACAACATAAAACACACAATCAGTCCCAACTCCTCCAACCTCTTCCATTTCTACAA
CGTACACGCTCTTCTGTATCTCTCAGCGCCGCTACTTCTTCTGCCGGTAGACGAGTCCCCCAGCATGTTCCTCGTGAGTCTGCCACCGTCGTCCTCCTCG
TCGAAGCTCATGGCGCGAGCACTTGCCGCCTGGGAATGCGCGTCCACAGACTGCCTAGCCGCGTCAATGTCCATCATGAGGAAGCTGGCGTGGCTGCGCA
GAGCCGAGGAGGACACGGGGACGCCCGCGCCCGCGCGGAAGCTCGAGCCGGCGCTATTGAGGCGGAATGAAGAGCTCAATCCGCCGCTGCTGAACGGATT
GAAGCCCGAGCGGCTGAGCCGCCGTCCAGCGCCCACCACGTGGTCCGCGGACGCGCTGCGCCGCAGCTCCATGACGTCGCTGGGTAGCAGCGTTCGTTCT
CCATTGCTGACGTTGGTAGAGGTGTTGGTGGAGGCGGTGGTGGCGCTACTGGGCGTGTTGAAGACGGCGCCGCTGCTGCGACTGCGACGACGAGGACGCG
TGCGGATGTTGGCGCGGTCGAAGTCGTCGCTCATGACGGGGGGAAGCCCAGGAAGAGCGAGGGGCAGAGCGCAGCACTACCCGATACCGACTTGGGATGT
GTCTTCCTGCAGCGCCACTTTTTCGTATCTAAGGATGAGTATGTGTTATACGTATAAATATGTATGCTACGTACAATAATATCAGAATTTCTGATTCGTG
CTGGGTGTTCTTCAGAATCAGTCCGAGAGATCTCAAGCGCCGGCAGCCCATTCTTGCTGTGTGATTGACTATGAGTGAGCGTCGGGTGAATGCGGCGCAG
GACGCGGTGATCAAGGTGCTGGTGCTGGGCGATGCTGCCACCGGAAAAACGAGCATCATCAAGCGGTACTGCGAGCTGTAGCTGGTCAGAAGCTCCAATC
AGAAGGGGATCTGACGCTGAATTTCTTCTTCGTGCAGATACGTGCACGACGCCTTCTCGGAGCACCACCGCACAACGATCGGCGTGGACTTTGCGCTCAA
GGCGGTGACGGTGAACGGCACGACGGTGCGCCTGCAGCTGTGGGATATCGCCGGCCAGGAGCACTTCCGAGCGCTTAACCGAGTGTACTACAAGGACGCG
CTGGGTGCGCTGCTGGTGTACGACATGTCTCGCCCAGAGACTTTCGACAGCGTTCTGAAGGTAACTGGAGGTTGGAGTGGGAGGCTGGAGGTTGGCTGCT
GATGGTCTATTTGTTGTTGTGATGCAGTGGAAGAAGGAGATTGACTCCAAGGTGGAGCTTCCAAACGGCAAGCCGCTGCCTGTCATTCTGTGTGGCAACA
AGGTGCGTTGCATTTGCACCTGAATTGAGAGGTGATAAGGTTCAGGATACGATGCTGAGTTTTTTTTTGTGGTGGGTTGTTGCAGTGCGACTTGAAGGAG
GACGTGGACCGGGAGTTCCTGGACGAGTTCTGCAAGACGAACAATTTTACGGGCTGGTTCGACACATCCGCCAAGGAAAACATTCACATTGATGATGCAG
CCAAGGCTCTGGTAACAGGTATCCTGGAGCACCAGGACATTTTCGAGCGGAAGTCTGAGGCCAAGAAACGCAATGACACCTTCCGCCCCACGGGTGCTGC
CAACGGAGGCAACGCAAACCAATCCAGCTGGTGCTGCAACAGCTTCTGATCTACTTCGCCTACAACTGCAACGAAGGTGCGATCCTTGAGGAAGCAGGTG
CTTTGAAGTCATGTTCGATGCATATCGTGCTTTGGGACAGCGTAAACCAAACTTTAAAAAGTTCCCATAGCCGTTGGCGCGTGTCTCCATCTATTTCATG
GCACTGGTGTTCTCTATGTTACTTATGCTTATCCTAGTCAAGTGAGCCTAGGAGGCGCCGCTTTTTCGAGCTGCTACCGGAAGATCCATCACCACGCCGA
ACCTTGATGAAATGAACTGGCAGTCGATGATTTCCTGATGTAGACATGGCACGGCGCTCCAAATTCTTGCGCACTTTTCGGAGATTATGCCGTGCGGCAC
CGAGCTTATCCGTTAATTCGCGCTTGCTGTCTTCCGCTTGCTCTAATTCATCCTCCAGTTGTATCACCTCCTGCTCCCGCTCATCAGGGCGATGATTTGT
GAAAGAAGCCGTGATATCGTTTATAATCTTCTGTACCTTCGCTTCAGCTTCAGGTTGCTGGGCCTCCATGAAATCAACGGACCGAACAAGCTGCCGTTCT
TCCACTCGCAAGCAATACTCGCAGGATTCACTCTCCTCGCGGGCTTTGCACTGCGACAGGTGCGCGAAATGGTGCTCCACCGCTGTGCACATTGGCTGGT
TGCAAACCTGTAAATCAAGGTGGTGTTGCAGATGCACCAGGATAGATGTGCAGTTCAGCAGGCACCGCTGTGCTTTCGATGGGGCACAGAAGGATGCATC
CACAATGGCATATCCCAGTTCCATGACACCATCAAACTCTCGCTGCACCACATCTCTACTCTCTCCGTTTTCAATTTTGGCTTGTAGCAGCTCGTTGATG
AAGTCTGCATTGAAGTTCACATTGCCTGGTATGCTGTTATCCTGTGTGTCTTGTGGCTCCTGGTTATTCAACTCGTCATCTGATAACCGCACAGAAGAGC
AAGAGTTAGCACGTGGTGTAAGTGATAGCCCCCCACACGGAATATTACCTGGCGTGAAGCTGTTATCATCCTCTTCACGGGTTGAAGCACGTAGCTCGTT
CGCAGGTACCTCGTCTTTAGAGGATTCAGCGGCAAATGACTCCGATGTAGTATTCTCGCTCATTTCTAGTGGTGTCGGCTCCCGTTTGATCAGTACAGCA
TCGCTGAAGTGCCACCGGTACTTCGGAAAGTTGAAGATAGGAGCGCTGCTTTCAATCGCTAGCTGGTTAAGACGGTCAGTTTCGGTGCGAAGAAGCTGCT
TGCGCCGAGTCCACGTGTTAATACTTTGCAAACAAAAGTTACGGTTTGCCTCGCTGTGCGCACTTTGAAGCGCACGACGCTGATCACTGATTAGATGATC
AAGCGCTGCAACCACTCCGAGACTCCGCCTTTGCCGGATGCGAATGCAAAACGGGCACACAGTCTTTTTGCCATCAATATCCGTGTCTTTTTTCAAGCAT
GCGCGTCGATGCCGGTACACGATTGATATCTCGAAGCACTTGGGATCGCTACATATTTCGTCACGTTTGCAATGTTCGTAATGTAAGAGGAGAGAGCGGC
ATGTTGGGTCTTCACATTTTCCGATTCTTGCGCATATAAGCGCGTCTTCGATAACAAGAGCAGACTCAACGCGCGCTGCCAGCATCTCCATCAGCACGTG
ATCAGTCGTAGGGAACCAACGTAGCAGCTTTTCGAGATCAAGAAGCTTGACCTGGGGAGCTGCACTTTTCGAGGTAGGAGAGGAGCGCTCGGTACGAGGC
TGTGTTACTGGAGTAGAAGTACCTCTCCGAGTTGTTGATGAAGATGGAACAGATGCAGAGGCAGCGGTTGTAGTAGCAGACGTTGAAGCTTGAGTGGTTG
CAGGCATCGTAGTCGGGGTTGGTGCAGGAGTTGGGTTTGTGACAACAGGAGCAAGAGGCGTCTCCTTGTTCTCCTGCCCCCTATCCGACTCCAAGTGCTG
TTCCTTTCTCGGCTCCATGTCATCTGCCATTGCTTCTGCTGTAGTAGTTGCAGCTTTCGACGCTTTTTCAACAGCAGGTTCTTTCGCCTTCTCCTCCAGA
TCACCGTTGTTCTCAATACTTGCCGTGTCTGCGTCCTCTCCGCTCTCCATTGATTCTCCCACTGTCTCAAACCCGAACTCCTCCATCGGTTCATCCTCCT
CTTCGTCCTGAAGCTTGGTCTGTTCTGAAAAGCCAGTATGTTGTTGAGCTGCAGGCTGGGTCTCTTTCGGAGCTGTTGCATCTTCGTCAGCCTCTGATTT
CTCGCTCTCCGTCGGCTTCTCAGCTGCAGCCTGTATATCTGTTGTGCCATCGGCTGACACGGACGGAGCTGGGGCACCATTAGCAGCCACACTAGGACCT
GCAGCAGCAGGTATAGCTTCTGTCTCCGACGTGTCATGGCTTGTTCCATTGCCGTTGCTCGCGTTAGACCCCCAGGCGAGATACGAGCGCGCCAGGCCGA
AGCGACTCGTGAGTTGGTGGCCGCGAGCAAAACCACGCGAGTGCCAGAGCATGGAGCAGTTCACGCACAGTTTCTTCTCGCAGCGAGGGTCGCACGTGGA
GCATTTGTAGTCCCAGGGCGACTCGCCGCACCAACCGCAGGCGCCATCCATGCTTATTGCGGCCATAAAGGCGACAATATATCGCAGAACTGAAAATGGC
GTGCCGCACACCACACTATTAGAAAAACGCAACGAGCAATATGTCACGACCAAGCCGGCTCTGTCTCGAGGTGTCTTGGCTCAGGGGCTTCATAACGCAC
AGTGCAGTGGGCAGGATATACAACATGGGGAAAGGATTCACTACGCTTGAGAAGGACGAAAGAGAAGAGATACGAAGGTGATCAAGATGAGTCATGAACG
CTGATGGTTTTGCCACGCGGCGCGCCGCAGAAAAAGCAAGCAGACACAGCTGCTGAAAGATCAGAAAGCTGCAGCTCCCCTCCCAAGCAGAGAAAAGAGC
TACATGCGCCAGCATGGACTGATGCCACAACGAATACAAGTCGAACACCACGACTCAGCACGAAAAACAAACCAAACTGAGATTTCGCTACTGTAGCTTG
CAAATTCCTGCTGCTTACCGACTGTTTCTGGCTCTCCATCTCATCCCTTGCTCACTGCAGCTAGCAGCCACATCACCCCGAGCTGCGTGCAGCCAGCGCG
TGGACGTGGACGAAGACCTCCTACTCCTAGCGTGCTCTAAGTGGCGTACTTGGCGGTCCATTCGCGGGCAGTGGCGTCGTGGCGCGCGCGGTCTGTTCTA
TAAATTTGCGCGATCTCAGGCACCAGCGGGTCGTCCGGGTTGGCATCCGTGAGCAGCGAGCAGATCGACAGCAGCACCTTGGAGATGGTCAGCGCGGGGC
TCCACTGGTCCTTCAGGATGTCCAGGCAGATGCCGCCGTTGGCGTTGATGTTGCAATGGTAGATGCGCGTCGTGAAGTTCACCTTGGGCGGCTTGAACGG
GTAGTCGGCCGGGAAGTAGATGTTCAGGAAGTAGACGCCGCCGGCGTACGGGCTGTCCTCGGGGCCCATGATGGTCGCTTGCCAGTGAAACAGGTCATCC
CCGACGGGGCCGGCGCTGCAGTTGGCGGGCGGGTCGCGCCCCAGGTCCTGCAGCTCCTTGTTGATCCGCTTTAAAGCCATCTTGGTGGTGCTCCTCCCTT
CTGTGCTTCGGCTCCGCTCTGCTGCTCCCTGCTGCGAAAGGAAAATGACCGCAAAGCTGCGCGGGCGAGGGGGGAGAAGGCTGCGATCCCCCCCAAAGTG
GCAACCGCCGCCGAATGTCACTTGTGTTTTGTATGGTGGTTCCCCAATTAGGGCCTTCTGGAAGTTTTTCTCCGTTTTGCTGTGGGTGGGTCGAAGCTCT
CGTACTTTGGCGGAACCGGCCTCCCCGCCGGACCCGATTGGACGAAACGTAGATGGTGCGCAAATTCAATTGGCTGAAATGATGCGGTTGAACAGCCTCC
CTGACTGCGAGTCGCTTGAGTGCCTGCTGCAGGACTATTTGTAGGCGTTGCCTCGCAGGCTGGCAGCCTGGTGCATCAGCAGACCATCGCTACGGATCAA
GTTGGTGCTGGCAAGTAGAAACGAGTGAATGCGAGACGAAGAGGTCCCTCGCAACATCAGATGATGCACATCACACCGACGCGATGATCTGCGCTTCAAC
TTGGCGGCAACCTTTAAGCTCGCCGGCAAGCACCATCGTACACTGCATTGCAATGCCACCACGCCCAGCTTTCAAGCGACTCGCTGGCACCAGCGAGTCG
CTGCTACCCGTCATCCTGCCGCGAGAGAAATATCTTTTGCGACCGCACGATCAGAGGCCATCGCCCTCTCGTCGCCTTGAAAGAGACGGCCTCCTGCCCT
GCCGCAACGTGCATGCACAGTTGACTGCCACTTTGCAGTGGCAGTGGCAGAGCAAAGGAATGTCGGACTGCCGACACGGCAGCATTGTCTGGAGGAGTCT
TCTGATGCCAACTTGACCAGAGCCACCTGTCGGCACGTCACGCGCTTCAACATGATCCCCTCACAGCGGCAGTTGGCCATCTGCCGCCTCTGGTCGACAC
GTCCATGCCGCTAATGAGAGTACATGTATTATATTTTAATACATATAATACCCAAACGCAGCGCTCTTCTCATGGCGCACTCAGAGCCCGACAAGTGCAT
ACCGGTACTCTAGACATCCCTATCATGCGTGAAGCCTCGCCGCAATGCAAATCTCAGCAACCCACGGTGCAACTTGCACCGCAAGAGGCCACAAAACCAC
AAGCCAACTTTTGCTTGCCTCGCACAACGCGAAGCACGATTTTACCCGCATCGTCGTTCCGTAAGTAACATTCGCTTAGTCAGGGTTCTTTCCCCTTCAT
ATATCAATGTACAGCTATTTCCCCGTACAACATATCCACTTACATAAACTGCGTTTATAAACCCTTAAGCACGATAAATACACCGTCACCTGTCATACTG
AATCTATCTATCCGTTCTTGCAGCGCCTAATTGCTTTGCATCAAAACTGGCTGGAATCGGTTGTCCAGCGGACGCCGCCACTCGCGCTCTTACGCTGCTC
CGTGGCAGTCGTCCTCCTTCCTTCCTCTCCCCACCCTCCAGCCAGACAGCATGGGCGATCGGTACCGCAGCGCGCAATCCCCGCGCAACAGCAGCGGCGG
CGTGTCAGACGACCGCTTCGGGAAGCTCGTGACCGAGACCAGCAAGGGCATCTCGAGTTTCAACCAACTCACGCGTAGCATGGCGCAAAAGATGTCACTC
TTCGGCACGCCGCAGGACTCGCGCGCCAATCACGCGCAGATCAAAGAGCTCACGGAGAAGGGCAACAAGCTTGTGGCTAAGATCAACCGCCGCCTGCAGG
AGCTCAACCGCGGCGCCAAGGGCCCCAGCGGTCGCACGCGCCGTACGCAGATGGGCAAACTCTCGACCGACTTCAAGAACCAGGTGCGCGTGTTCGAGGA
GACGTGCGAGCGGCTGCTCGAGTCGGAGCGCCAGTCCGTGGACTTCATCCGCCGCTCCTCGCAAAGCTTCAAGGGCGGCGACGCGCGCCAGACCCGCGGT
GGCGCAGAGTTTACTAACTACAGCGAGGACCAGATCTACGCGCAGGCCAATGTGGTCATCTACGACGAAGACGGTGCGTTGTGCTGCTTGCTTGTGGTGG
GTTGGCAGTAATTCTTGACGGGGAATTATTGTTTTATGGTTTCGACAGATCTGCAGCGGAGAGAGGACGACATTATCCAAATCAACCACCAGCTGCGCGA
GGTAAACGCGGCCTTCGAGGAGATTGACGGACTGGTACAGGATCAGGGCGAGATGGTGGTGGAGATTGTAGAGAACACCGACACGGCCAAGGACAACGTT
GAGAAGGCGCTGGAGCAGGTGCGTCAGGCAGACCAGCGCAAGAAGTGCTGCGCTTGCTCACGGATGAAGCTCATCTGCGTCGCCATCTTCGCGCTACTCA
TCTTCATCGCCCTCATGGGTATCATTTTCGCCGCCAAGTAGGTTGTGTCACTTTGGTCATTCTGGCTTGCTCTTGTGAAAACGGTGGGAGATGAAGGTGA
CAACTGCGCAGCAGGCAAGCAGCGAAAGCCGGTTTATTTCTAAATAGTAAGTGGGTTGTATAACTTTGTGGTGGCTGGATATCCCTTTGTACATGGTTTA
TGCCTAGCCGAACGGTCGTTCAGAAGCTGGTGCTAACGAAAACCAGCAAAATGCCTTTTGATATCGGTAGGACGGTGCAAAATGGTGTTGGCTCGACAAT
TATTGATGAGTATTACCTCGGAGTCACTAACGCTCTGGTAGTCGGCCACGAGCTCCAATCTCTGTTATCATCTGGGACGCTCGTCGCGGCTCAAAACTGA
GCTTCGCCCGCGAGCCTCGGAAAAAGTTGTCCACAGATTTAAGCATTTTGATGACGGAGCCGCTACTGTGTCTTCGAGACCGAATAGGAGCAGCATTCAA
TCCTGTTGTGGTATCTTCGGTGGCGTGATGACGTGCAAGAAGGCGGGCTCGCGAAGCAGCTTCCGAGGACGAGCTGCCACCGCTGCCTACCTGCTTGGTA
CTAGAACTTCGACCTGTAAAGCGCAGCCTCGAATCGACTGAAAACATAGCTGAGAAAGGAACGGCTGCGTCGCGCTCGGATGAGTCGAAGCAAACTGCGC
AGACTCGTTCCTTGTCGTTTACATCCTCAACAATGCCGTTGAAGTACCGTGCTGTTCCATGTACGCGAGCCATGACGGCTTCGCCGACGGAGAAATTCAC
AGGAGACAACTCGAAGCCCATTGTGTCGATGCTGAAGTTTGTCAGACGCTGACTGTATGATAACGCAGTGGTGTCGTCCAAGCGCGTGATTTTATCAGGC
GCCATTTGTGCTTTCTGTTCACCGTAGTCGAATACCAACGTGTATAACGACGTGGTGGCTGGTGTCGCGATTGAATGCACCGTTGAGGATGCCATCACAT
CTGAGCTAGAGATCGAGCTAACTGACGGTGAAAGTGCTCCAGGGACAGTGATGGAGTCCTGTGACGTTTTGGCGATGATTTTGGCTGAGCAATAGCGCCC
AAAACGGGAACTCCAGGCTAGCACGTATTCTCCCACGACAAATACTGGTACTGCCCGGTTGCAATTATCGTTTGCAATCAACGTGGAAGCTGCTTTTGTT
TGTGTACGTTGCTGCTCCACGCTATCAAGAATCATTTGCGACGGAAACACCTCGAACGCGATTGTGCCATCCGAAAAACGCAGATCACACGCTGAAGAAG
CGTGCGTCTTGATGACAATACAGCTCTCGACTGCAGCTTTCCGAGGATGATCAGCCTTGACTTGGTACCCTTCTTCGAGTACCGGCAAATTTACTTTAGC
TGAGGCCTGCATGAGAACAGCATTCTTGAGGGATCGCACATCCTGGTCTGCAGGCACTCTTACGCGCTTCCGCCTGAAAATTAGGTGCGGAGGCACCTCG
TAGCCAGTAGATCCGTCAGCAAAGTCTACAGCAGCAGTTTTATTTGAGTAAACGCCATTCAGAAGCCCCAGCTTCTCTTCTTCAGAGGTGCTGTCTAGAT
CACCGTTTCCAGGAGAGCACTTGACGTAAATCTGATCACCGATGTAAACCTTGACCTTGTTATGGCAAACGAGGAATTGGTCTTCCGTGATGGTAACTGC
AGCTTTCTTCTTCTCCCGCAAAGGACTGATCTTGTCCGCAGGAACATTTACAAGCCGGATACGATTTGCAAGCAAGACGTGAAAGCGCGATTGATAATCC
CGTTCCAGAGTTATGAGCCCGCGACCTGAAAAACGGCTACCCGGATACAGCGAAACCTGAACCTTTTGGCCTGCAAAGAGCACGCGCTGTGACCACTCTA
GGTCTGTCAACTGTTGTTCTAGCTCGCACACGGATGGCAAGAAGTCCACTTTGTCTATCGGCACAACCTGCACCGAAATACTGTGTTCATCTTCCGTCAC
CACGGCGAAGCCACCGCCTTCAACTTGCTTAGTAACTGTTCCATAGGCGCGTATACCATCAGGAGCTCGCTCGTATACAACTCGGAGACTGTCAGAATCT
CCTCGCGATACAAGAGTTGCGGTAGGAGATCCTGAATTACATCGAGTTATCCGCATACCATTAAGCTTTGCATCCATCAGACGGATCTGTTCACCCAATG
CGAGCTCACCAGTAAGTTTTGAAGGCTGCACCTTCTTGTTGCTACGGAGGAAGTACTCGGTGATAACCTGTTTGAGACTCTTTGGCGTGGGAATAATTTT
CTTCATACCTTTCTGCGTTATTGAAAGCCGATCAACCTGCGAGACCGACGAAATGCTCGAACGTCTCCCTGTGCCACGTTGAGCACGGGTAGCTTTTCCC
ATACCGAAAGTCTGTGTCATTTGTTGCCACGGCGTCATGGACATATCCTCTTCGCTGGATTCGCCAGAGTCGCTTACTTGTGTTGAGTCATCCTCGTAAC
CCACTCCACACTCAAGTCGCTTCATCGTCAGAGTTTCATCCTCCAAATGCAGACGCCACGTTTCGATTTCTGAGCAAATTGTGCCACACGGAGCGCATCC
ACTTTCATAATCGCCGCCGTTGGCATCGAAACTTAGCACCATTTCTCTCGGAGGCGTCACAGAAAAATCTACCATGACGTGCTGCAATGGTAGGAGGTAT
AGCTCTGGGGATACTGATGGATCTGAACACTGCTCATCATGCTCTTGATCTTGATCTTGCAGTGATTTCCTCCTGACTGCAGAGACTTTGACCGTGTTGG
AATCATCGCCACCCAAGCCACTAAAACTATCAAGGTGCAATGACTCACTTGTTCCAGAGCTCTTCTGCCCTTGCTGGTCGTGTTGGTAACTTTGTTTCCT
CTTTTTTGTAGTCATCGAAGGAGAAGGCGGCGAAAGTTTTTCTCGCAACATGATATCCTCGCGGCGTACTCGATAATCCAGAGTTCCGTCATCAAAAACG
AGCATGAACATACCTGCGCCGAGATATGTGGCGATATTTCCCGAGTAGAAGTACGGCGTCTTCTTGTACCGTCCAAAAACGTGCTGGCCGTAGGTCCATT
GACTATGAAGTGGTACAAATCGTGAAATGGGGCCCTGTGTAGCTTGCTCTGAGACTGACGAAGCAGGGATACCAGAGGTATGGTCATGCTTGCTTTGAGT
TTGGTGAGTTTCATCATGGTGGTCATTGACGAGGTTAACACTCTGGCTGCCAGGATCTCGGGTATCTACCGCTCCAGGGGCTATTGGCTTTTTGGGTAAT
CCAGGTAACAAGTCCTTCGTACAACTAGCCCCCCCGTCGCCATGCACTTGGTGGCGATCACCAAGTTGTTGAATCGGCAAAATCGATGTGGTTGTCTTCA
ATGAAATCTTCTGTCTGTTAACAAGAGCACCGTCGTCATGAAGTTTGATGCGCTCAGAGAGCTGTCGAATTGGTGAAAGTGGAACGATCCTCGTTGGTAT
TTCCTGCTTCTTGACAGGTACATCGTTATTGTGGACCTCGTTCAGTTCTTGAGATGGAGACGACGGCCTGCTCCTATTTAGCGACATAGCCGGAATCTCC
TGTGTTCTGATAGACATGGCGTCATCGTGAATTTGCAGACGCCCACTAAGCTTAGCTGCGGACGATGGTCGGCTAGACCCGCTTGCATTTCTAGTTGACG
ACTCCAACTTGGAGTTGATGGGCATCTCGTTGTCCAGAGGCTGGAATCGAGCACCGTACTGCTGCGAGAGTGAAGGTGTATTGCTCATCCGGGGAGAAAT
CGCCAGAAATTCATCTTTGTTCACAGCTATTCCGGCGTCAGGTACTTGGAAGCGGCCACTGAGTCGAGATGATAGTTGTCTGGGTGTTGCTGCCTTTGGT
GAGGCATCTCGGACTTCGATCGGTTCGGCCAACACCAGGTCATCGTGAATCAATCGATGGCCCGTTGACTTTAAAGCGGACGATGGTCTATTTGTCGGTG
AATTGGCCACCTTGAACTCTTGCATAGCCTCTTCATGGATCGGAAAGCGGCCGCTGGGGAGTCTGAACGACAACGCTCTTGCCGTCCTGGAATCGGCTGT
GCTGACACTGCGCATCTCATGAATCAACTTGCTTATCAGTCTCTGCGCTCTGAGTGTCGAGTGCGCTTGCGAACAGGGAACCAAAGGAGGACCAGGACTA
GCCCATTTATAGCAGAGT