Description :
From Genome Similarity Track
Location :
Scaffold_162:70960- 75051
Transcript NameFunction/comments
Phyci_97351phospholipid-transporting ATPase, putative

Sequence
4091 bases(100 bases per row)
GAGTTGCGCATGGCCGTCGAGATGGCGTCCGAGCGCGGCAACGAGTTGGACGCGATGTACGACTCGGCTAGTGTCGTCTCCTCGTCGCAGCTGAAAGCGA
AGCCCGTGTTGCGACGACTTGTCGTCGGCCGGAACATCTTGGCCGGGACGCGCTCCCACGTAGCATCCTCGGAGATGGACTCACTAAATACACTGGCCGA
GTAGCTCTCGGCGACTCCAGAGCTGACAGAGCCCGACGCCGCTGACTGGGGTGCTGACGTGCGACTGACGCTGCTCTTCTTCGGCTGCTCGTAGAGCGTG
GCAGCGGTGAAGCTCTGCGGGTGTTGGGCCTTGAGAATCTCGGCGTCGGAGTGTCCGAAGTCGCTCAGGTATCCAGTGGTGTGGACGTCGTCCAGCGACA
TGGAGAGAGTCTGCTCCTCTGAGTGGTTGATGGTCAGGCGTCGCTGGTACTTCCGCTGCGCGGCACCTCCCATGGACTCCTGAAGTAGCTGAGCCAGGTC
GGGATGGAATGTCCGCTGGTACAGGTTGTATGCAATGTGACGTCCCAATGCCAGCGAGCACCCCATGATCAATACGAGGAAGTAACCCCATGTCTTGGCA
GTAGGAGCAAAGGCACCGAACTCGTCGTAGCCGACCTTGTACGTGGCAAAGTACGGCGTCTCAGTACCAATAGCGGCAAAAGCAAACCACGACATGACAC
TGCCGAACCAGAGCGAAAACGAGAGCACCGTCCATCGGTCAGCGATCATCCAGATTTTGATGTTCACGATCAGCACCGTCAGCGAGAAAGCCACCATGCC
GAACTCCACACGCGACTCACTACCCGCTGCCTTCTCCGATGCGTTGAAGCCGTACGACATCACCACGAAGATGATCATCGACTCGTAGAAGGCTGCTGCG
ATCCAGCGGCCGAACGTGTACATGTTGAAGAAGAATCGCTCCGGCCCACGACGGTACAAGTCAGGGTACTCGAGGCTGAACGGAGCCGGGAGGTCCTTGT
CCAGCACACCCACTACCACAATAGGCAGACCCGTGAAGGCCACGTTGTACAGCTGCACACCGATTTCCCAGTACATCTTGGAGCCAGACGCGCCAGAGAG
GTAACCGTACCAGTACTGTGCCAGCACAAGTGTGATGTTCTTGTAGAACATGTACAGCACCAACTTGGAGATACGAATGTAGTTCCAACGTCCGTGAACC
AACAGCAGCCGCTCAAGGAAGCGGAACTGCGCAATGGCGTAGTCACTCGAGTTGACAGCCTGCATGCCTTCCTGTCCGGAGATACCCACACCGACGTGAG
CGGCTTGGATCATAGCGACATCGTTGGCACCATCACCAATAGCAAGAGTTCGCACGGTTGTGATGTTGTCTCTGACGAGCTTCACCATCTCAGCCTTCTG
GGCAGGAGACACGCGGTTACAGATCACCGCGCGGCACAGCTTGGCGAACGACAGCAAATGAGGTGCGGTTCCAGGTCGGAGAGCCATCTCCAGTGCCTCG
CCATCGATAATTAACGAGATTTCCCGTTCACCTCCACCTGCCATACCCTTCGCGTTTTCCATGAATTCACGAGCTGCAGCATTCAGTTTGGCGCGAATCG
CTGCCTCGTCCGGACATGTAGTAGCGTTCACGATAACTTGCTGAATGGAGTTGTCCAGCAGCGAGCAAGCGTACGAAATGTTAATGGCAGTTTCCTCCTT
GTCGCCCGTCAGCATCCACACCTTGATACCGGCACGCGTCAAGTTCGCCAAGCACTGCGGCACGCCATCCTGTAGTTTGTCCTCGATTGCCGTCGCTCCG
ATGAGCTCCAGTCCCTCTTCAATTTCTTCCATCAGGTCGTCAATTGCATTCGGTTTGCCATCTTTGCGTCGGTCGATCTCCGCCACGTTACCCTGAGCGT
CGTCGAAGCGCATTTTCCACTGCTGGAACCAGCGTTCGTCAAGCTTCTTCATCGCGAGGGCCAGCGTACGCAACCCATCGTCCGCGTACTTCTCCATGTG
GTCGCGCGTAGTGTTCTTGAGCTTCAGCATCGCCGGATCATCCTTCAGGCGCTGGTAGATCATCATGTCGGCTCCCTTCGTGTACAGCAGCAGCTCACCG
CTAGGTTTGCGAACCACAACTGACATGCGCTTCCTCGTACTGTTGAACTCGAGAACGTCCAAAATCTCGTACGACACGCGCTGGCCCAAGACCTCCACAG
TCGCTGTTCCTACGCTACGGCTTTCGAACTTGAATCCTGCAAAGGCTGCACCAGCCACGAGGGCCTGTTCATCAGGTGACGATGCTGATAAACGGACTTC
GCCAGACTCCAGCTTCTCGGGGATCACCGTGTGGCACACGGCAAGGTGCTCAAAGAACTGCAGGATTTTCTTCTTCTGCTCCTCTCCAGCACTGCCCTTC
ATGCCGTCGAACAGAGCCTTGTCCACGAAGTTCACGAACGGGATCTTCTTGATGCTCGGATCAAGCTTGGGCTCCGGCGGAATGGGCTTCCCTGCGCGAA
CGAGCGCTGCGCGTCCAATTTCCGTGATACCTGAACCGTAGGAAGTGCCGTTGATGGAGCACTTGCGGAACTCCATGATGTTGCACGTGAGTGTGCCGGT
CTTGTCGCTAAACACGTACGAGATCTGGCCCAATTCCTCATTCAGCTCCATCGTGCGCACAATCGCGGGCGTGTCCGTCTCGGCATGGTACATCTCGAGG
TCCCACGACATGAAGCGCGACTGCAAGAACTTGACGCTCGTCATGGACACGTACAGCGAGATGGGGATCACCTGGTAGAGCAGCAGGAAGTAGTAGAACA
GCATCTGGATGAAGGCCACAAACCGCGTGCGATCCCTCTCGGCGTCCGTGAGCTGGATATACCAGGTGTTGCGCACAATGTCGTACTGCCAGGTGATGTA
GCATGTCGCGGCCACGGCGCAGGCCACGAACAGCCCCATGCAGAGAATCACGATCATCCGGTTAATGTGCAGCATGAGGTCGCTCCACTTGGAGGGCGCG
GCGCTGGCGCTCTGCATGATCTTGGTGTCGTTGCCCGTGTTGAGCACGAGGCCGAAGACCCAGTCCGTGTTGCGCAGGTTGCAGCCGCGCAGCAGCACGT
TCTTGACCGAGAGCGGCATGACCTCGACGCCGCAGCCGTCGCCCACGGTGACCTCGACCTTGCCCGCGAACTTGTTGATGTGCGGGTTGGGCTGCTCGCA
CTTGACGACACCGCGCAGCAGCGCCAGCTCAGCGGCGTTGGCCAGCGAGCTCATGGTGGCGGCCACGGCCTGGCGCAGCTTGAGGTTGGTCTCTCCGTCG
AGGCTCTTGGTCTCAACGTAGCAGATGCCGCTGGGGGGTTCGCCCACGGGCTCCGCGACGGCGAGCACGAGCACATCGGCGGGGATGACCTCCCGGTTGC
GGATCTGCAGGAAGTCGCCGACCTTGATGTCGGCCCACTTGCGGTCCACGACGTGCCCGTCCTGGATGACGTGGCACGTGGCCGAGTTGGCCTCGTTGTC
CGACTTGTGGCGGCGCAGGTCCTCCATGACGGCGAACACGGCGTCGATCGAGATGACGAAGAAGAGCACGGGCGCGTTGGTCGGGTAGCCGTACGTGTTG
GAGATGCTCGGGATGCTCTGCAGCACGCAGACCATGAGGAAGAAGAAGTTGGCGACCTTGGAGAAGCTCTCCTTGAGGAACTTGGGCAGGAACGTCACGA
CCGAGTACTTGGACGTGACCACCACGTTCGAGCACTTGTCGAACGCCGCGTTGCCGGGCGCGTAGTTGAAGTACACCTCCCTCAGCGCCTCATTGTCTGC
GTGACCTGCTCCTGTAGTACCCACCGCCCCGCCAGTGGCGGCGGGCGTGTGCTGCGCCGCGTAGTCCACGAGCTCGTCCTCGTCGGGGATCTGCTCGTGC
TCGCGCCGGCTCTTGCGCCGCCCCTGGCGCGGCGACTGCAGCACGGGCGCGGGGCTGCCCAGCGTGTTGTAGCCGCCCGAGCTCGAGCCCAGCGCGTGGT
CGGCGGCGGGCGCGACGCTGGCGCACAGCGCCACCTCGTCCTCCACCCGCGAGCCGCGGAAGATGCGCGACGTGCTGCGCTTGGCCGCCAT