Description :
From Genome Similarity Track
Location :
Scaffold_940:7096- 11893
Transcript NameFunction/comments
g11952.t1POM61253.1 hypothetical protein PHPALM_29758, partial [Phytophthora palmivora var. palmivora
g11953.t1KUF82011.1 Centromere/kinetochore protein zw10 [Phytophthora nicotianae

Sequence
4797 bases(100 bases per row)
TCTTCCATGTGGTCGCAGATGTCGAAGTGGAGCAGCTCGAACGTGTCGTGGCGACGCTTGTTACGGTTGCTTGGGAACGGCTTTTGGACCATTTTCCCTT
GCTGGCAGCCGCGACACACGCTTGGTCCACTCGACTTGGAAGGTGCCTTCGCGTCCTTGATCATGTCGTTGTCGACCATCTTGCGAAGCACCTCCACCCA
TACGCGCGTGCAGGTCGACCGTCTTCCCACTGGTCGCTGCATTCGCCGATCGCTGAGGCGTCTGGAGCCAGTAGAGGCCATCCACGAGATTCGCCGCCGC
CACCACTTGTTTGGAGGCCTTGTGTGCAACGCGCATCTGGGTGCCGTCGAACACGATTTGGAACAGACCACTCTTGTTGATCTGTGGCACCGAGAGCAGA
TTCTTGCTCATGCTCGGCACGTACAGCGCGTTCTTGATCTCGATGTCGCGCTCGTCGCCGTTGGGCAGAACCACTCGTTCCACGATGGTCCCCACGCCGC
CTTGTTGCCGTCGGCCACCGAAAGTTCGCCCTCGTTTCGCTCAATCAAATGGGCGAACTTGGCCTTGTCGTTGCAGATGTGGTGCGTTGCGCCGCTGTCG
ACCGCCCACATGCCGATCATATCCTTGCCCGTCGAAATGCCACACTCCAGTGAGACCGCGAACGCCACTCGATCATAGCCGTAGCCGTAGTCGTAGCTGG
CGTCGTCGTTCCTCCACTGGGCATTGTTGGCCCCGCGTCCACGACCATTGCCATTGCCGCCGCGTCTTGGGCTCCGATTCTCGTCCTTCTGCTTGGTCCA
GCACTTGTCGATCGTGTGCCCCAATTTCCCGCAGTACGTGCACTGGCGAGACTCTCGGTCGGTGTTGAACGCCTTGGCCGCGTCCTCCGTCTTCACCGTC
GCCGTCTTCTCGCCTTGCCGCTTGATGTGCTCATTCGTCAGCACCTTCACGACGTCTTGCGATCGGAGCTCAGCGCTACTCATCTCCAAGTTCAGCACGG
CGTTCTCGTAGCTCTTGGGGAGACTGCGCAACAGGCAGATCGCCACGTCCTCGTCCTCCATCTTGGCGCCGATGCTGCTGAGCTTGGCGCTGATGTTGAG
GACCTCGTTGCAGTGATGCAACACGTTCCCGCCTTCCGACATCTCCATGCTGAAGAGTTGGCGCTTCAGGTAGATGCGACCAGCCTTCTGCGAACCACCG
TACAGCGTCTTCAAGCGCGTCCACGCAACCCACGCTTCCTCGCAGTCGTCGACCACATGGTGGTAGTCCGCGTCCATGTGGAGCAACATCAGTCCGAACG
CGATGTTGCTCGACTTGACGTACTCGTCCTTGGGCCGCGGGTCCGTGAAGCTCGGCGTCGTCTCTCGGTTCACGACATGCCACACCGACTTGGTCAGGAA
CACGCCACGTATGTAGCGGTTTCACGTCGCGTAGTTGTCTCCGTTGAACTTGTCGATGGAGACCTTGGTGGAGGCATCGTGGGCAGAGGACATGGTGCTT
GGGCTCATAACCTGATGGAAGGTATGGATCTTGACACCGAAGCTTGACGGAGCGGAGGGAGGGCAGCACTCTCGGCGAGACTGGAGCGGAGACTGAAAAC
CACTTGAGGGGTAGAACGAAGATTCGAAAGTGATTGATTGAGGTCTTTAGCTTGCTAGCCTTCTCGCTACTCTAGACCTACTGGATACACACTACTTGAT
TCTTTACTGGATATTGAGTTACTTCAGCCAATGAGAGAGCGCCACGTCGAAGCCCATCTTGTACCTACAATATTGTACCCACAGGTGGCGTAATCGACAG
TGGCGTAATCGACAGTGGCGTAATCGTCGGTGGCGGAATCGGCGTGGGTTCGGATTGGACCGGTTCGGGTTAACCGGTTCACGGTCAACAACCGATACCA
AACCGGTAACCCTCCATACCCTCAATAAAGTTGCCCGACTTTTTGTTTTCCGAGCCAAACAAACAGCAGGAAAAAAAATATTTGGGCAGTTATCACCACG
CACTCATCGCCTAGCCCTAATGTGTTCGCTTGCCGTATTTTATCAGAACGTTCGTTTTTTTAATGGAGAAGTCCGTTTTTTATTGAATAAGAATTCGCTC
CTGTGGAAGACTTGATACAATCAAAAATAGTTTGCCAAACCTTGTCAAAAATATATTCAATGGCATTTTTTTTTGGCCAAAACCTCTGAAAAAATATGTT
CACAAAAACCATACCTTTTATACAGGTTTTGTCAAATTTTTATTTTATCAAGTTTTATAGGTGAGAATTTATCTATACAAAACGGACTTATCCATAAAAG
ACGTACTTAAAATTGAAATGCTGGTTATCCAATTTTCCTATTGTCATTTTTCAGCGCAAGAACAGAAAATGCTGTCGCAGTCCGAGTTGACCACGTAGGT
TGTCTCGATCTGTGCGTCTCCTCCGTATCCCCGCACCAACTCTCTCTCTCTCGCCTCCACAGGAAACTCGAAGAAACGCATGGCGAAATCGTAAAGGTTC
GGGGCGACGTGGTCGAGGCGCTGCGCTCGTTTTACGCGTCGTCCTCCGCCATGTCGGCCGACGAGGCGATCAAGATTGCGGCCCAATGGGGCGCGGTGCA
CTCATTCCCCGTGGCGGGGGACGACGCTGACGCCTCCGACCTGCAGGAGAAGATGCGGCGCCTCAACGTGGCGCTGCTGGACGCCGTGGACCGCCTGCAG
CTGGATGAGCGCGACGAGATGGCGCCTGAAGCTCAGCTGCTGTTGTCCTTGACGCAGCGCGAGCAGCTCAAGAGGCAGGTACAGGAGTCCAAGGCCATGT
TGGCTCTGATCGAGCAGCTCATGGAGATGGACAGGCTGCTGGGAGACGTGGACGAAGCTATGGGCCAACAACACTTTGTGGCGGCGGCCGAGGGCGTTAC
GGAAGTTGACAGACTCTTGCAGGACCTGGTGGTGGCAGAGGGAGGAAATGTTGGCGAAAAGAAGATTGTTCGAGTGGTGAAGCTGCAGTCGATGAGCAAG
AAAAATCGCTTGTTGAGTCAGCTCACAAAGTATTTCGCCTGCACTGCGGTGTGGAAGGACGGCATGCTCAAGGTGGCGCCGGGTTTCTCGGAGAATGAGT
TTGATACGGCGGGTTTGTCGGCGGAAGAGCGGCGTAGTGCTTTTTGGAGGGCGTGTGAAGTGCTGGATATGCTCACTCCGAAGTTGAAGGAGATCGCCAA
GTCCATCTCGCAACATCTCATCAAGCCGCTGCTGCTGCTGCCACGAGCGACAGTAAAGCAGACACGGGATGACAACGGTGCTGTATTAAAGATTGAGGCG
CAAAATGCGAATGGTAATGCTTTGTCTGCTAACAGCGAGGTCATCGAGGTGCAAGGCAAATGCGCCAATGTTGTGAGCGTGCTCCAGTTCATCCACTCGG
AATTGTTCGCGGGCAATGCCGAGCTGATGAACCAACTTGGAGATTTCATGTGGAAGATCCCAGGCAACCTTGAAGCTCAACTCATGAATTTGCTACAGGA
CAAGATCCCACAGGATGTTGCTGCCCTCGACACATATCGCGATGCTCTCATGACTACCGTAAGTCTGATCATGCGAGTGTTATGTTTGGTAGAGCTAACA
AGAGACGAGTACATTTTGATTGAACGCTTAGGTTGCGAGCTTGGAAAACACGTTGGTGGCGATCGGGTTCTCAGCCTGCAGTAACAGCCAACTGCGAGGA
TTTGTTGACCAGCTCAACCAGTACGTTACTGTGAATTCGCCTAAGGTGTCGACATCATTAACGCGATGTTGCATGCGTTGGCTTCAGGTTCCATTCGAAG
AAACGCCGCCAGGTCATCCTAAGCAGCGGGCGCGACTTGATGCGTCTAGGGTACCACGATTCTGTCAAGATCAAGGGTGCCACCGAGAAGTGCAGTCTCA
ATTCGTCCGTCGATTCTGGCAAGAAAGGCAAAGGCGGAGCTAAGGGTGGCGCTGGATTGGGTGCTTCGCCCATCAGCTCGAGCACTGATGAGGTCGAAAG
TAGCTGCTTTCAGGTACCTGACTATCGCGTGACTGCCTGCGCTCACGAAGTAGTGGGTCTGGTGCATCAGGCGCTGCTTGAGGCGTGCACTGCAGGTGCG
GCGAGTGCCAAATTACTATTTCAGACAGCTCGCGACCTCTTCTTGCTGTTCCGCACAATCGTGCCAACGCTTTATGAAGACAACATTGCGAACGACCCGC
GGGCTTGCATGCTCTATCATAATGATTGCCTCTACATCACGTATCACATGCTTGTTGTCGGGCATCTGTACAAGCACCGGTGAGTACAAGGCATATTGTC
TATGAGTACGATATCGTCCACTAATACTAGCTCCTGTGCTGCTGTAGACTTCCAGCACCACTGAATCAAACTGCAACAATGGTCGATATGGTCCCCTCAT
TTAGGGATGCCGGTGAACGGGCATTGACTTCATATGTCGCTGCACAAATCGATGAGGTTACAACTGGAATGAAGGCTCTGCCGGTACAACTGCTGCCATC
ACCTGTGAAAGTTTCCGAACACGAGCTAACCTGTTTGCATTTTATATGCTGGATAGTCGCTTGGAGCTCTTGATTCAGAGTACGACATGGAGCGCGTGGA
AAGTTTCTTAAAGCGTGCGCTCTACAAGATAAATGGGATGAGCTCATCGTGGCAAGAAGGATTGCCTCTAGCAGTGTACAACAAAGTCATGTCGCGGGTG
CTCGAGCCGCTTGCGAAGAACTTCGTGGATGGTGTTTTGACCCAATCGGTATGTGCCCCACTATCACTATTCTCTGGAGGCAAGCTACATGTAACCG