Description :
From Genome Similarity Track
Location :
Scaffold_157:7096- 10839
Sequence
3743 bases(100 bases per row)
TCGAAGTGGACGATGCCATTAAGGCTCGCCACATCGACGATGAGGAAATGCAAGTTGTATTTGCCAAATCGAATTTTTCAGGGCGTGCCAGAACTTGGGC
CCTGCATCTTTAATTACAATATCCAAACGTGTTTAGATCGCTGGTGGTCTTTAAGACTCTGATCAGCCAAACGTTTAAGTCGCCAAGAGCTGAGTTCAGG
ACTCTTTCAGAGCTTCTGAAGATAAAACAAGGTAAGCATGACGTTAACGCTTGCGCTAAGCACGTTCGTTACCTTTCAAGTTGCATGGTAGCGAACCCTG
TAAGTGAATTCGTGTTGATCACGATATTCTTACAGGGCCTTATAGATGGTCCCGTGAGGAACCACGTATTCTGCATCAAGTTGAAGTCGCTTGAGGAATC
GATTACAACTGCGGTGCAAGAGGACTTTAGTGTGAGACAGGATTACACTAGCTTGACCCCTTATCGTCCTTCGAGACAGTAGAGGCGGGAGGTACAGAAC
CAATGGAACTCTGCAGTGTCGAGAACGAGAGACCTCGCTCATCAAGCAGTTAGCGATTCAAAACAAAAGTGCAATCGCTGTCAGAAGTTAGGACACTACG
CATACGGGTGTAGTGCTTCACGCCCAGTGTCTCGTAACACTGAGCGAAGTGATCGACCGCCTGTCAAGAAGGGCAACGGACGCGGGTCCGACGCTGTTGC
GAAGTCACAACAGCGTAGAGGACCGTAAAAAAACGGTCGGGGTCAGCAGGGGCGGAGCTCCCTACTGATCCAGCAATCTCAATAGAATTTGCAAAATTTA
CAAATCTATTGATGAAAGTTGCTCCAGACTCACAATACTTGTGTGTCTCTGCACTTGGTGAGGTATCCCTAATCACCTTGAATTTAGAATTGACAAAAGA
TTTGTCACTTCGTGCTTTAGTTGACTGTGGTTCGTAGAACAACTTTTTTCGTTGCCAGTCGATAGAGGATCGTAGGCTCAAGTCCGTTGAGCGCGTTACT
CCTCCTACGAGGTTGTCGGTGCGCCTCGCAACAGACGCATCGATAGCAATGATGAAACGTGTAGTGGGATTTCACTACACGTTAGAAGATTTGCAGTACA
ATGATGATTTCATCGTACTTGATTTGGATGACAAATTTGATGTCATCCTAGGGTTACCCTGGCTCAGAAGGTACGAGTCAAGGGTCAGCTGGCAGCATCG
AACCGCGAAGATGCCTGCCACTTGTTCATCAGATGGCCATCTGATGAACGTTTTGGAGCGTCCACAAGCGTGTGGATGTACTGTGAGTGAGTGCGATGGC
CTCACTTGCGGTACGGTAGTTAGTACGACTGCACAAGATCACAGTGTGACAACCAATCGCACTGTGGAGGAAGCTGCCGGCGGCTGTGCGGATACACAGG
CAGCGCCGAAGGTCCACCACTCGAACAAGTCGAGTGCATCGGGACATAGGTGTGCGCCTAGCGGGAGACATCCAAGTAAGAATATACCAGTTGCCCACAC
AGGGCAACACGATGATCCTAGATCGACTGGAGAGTCGATCGTAGCGGACATAGCTGTGGTAGCGCAACCACAGCTAGAAGACGTCGAGGGAATAGGCCCC
ACGTACTTGAGGAAAAGGGTTCCCAGGAAGAAAACGAGACATTGAATGTATTGGTCAATGACGGGTCAATTGTAGGCGCTTATACACTTGATCTGATCGC
GCCTCCGAAGTTGACTTCGAAGATCATTCAATTGCCAACGCTAGAACCGAAACGGTTCTTGCGAGATCTGCGTAGTGGCAAGATCAAGCAGATCTATGTA
CTCGTCACGGAGGACGAGTACGTGACCGACATTCGGTAGGCAGTAATATTTGCAGAGAACGAACGAGTTATCAGCAGCTCATCAATGGACGAAAGTGTCC
TCGATGAGAAGACTTGGATTGAGAGACACACGTCTCAATCTTGGGAGTCGCTTCAGGCAAATCCTTTATATAAGGATTTGATCGAATTCAAGGATGCATT
CCCTGAATCCGTACCATGCGAATTGCCTAAGGATAAAGGCACTCGACATGAAATCGAGCTCAAACCGGGCTCGAAGTACTGTGTCATGAAGCAGTGGCCA
CTGACTCGTGAGCAAGTACTTGCGATCGACAAGTTCTTTGCCGATCGCTTAGCTGCGGGTCATGTGAGGGAGTCAACTTCCGCTCACAGCTCTCCGACCT
TCTGTGTGCGCAAGGCCACCGGAGGATGGCGGATAGTGCACGCATTCAACAAGTTGGATGCTGCAATGGTACTGACTCAGACGCCGATACCGAAGAAAGA
CGTAATCATTGATGGTATGTCAAAGAGTACCATCTTTTCGTCCATGAATCTGATGGATGGCTTCTATCAGATCCTAATGCGTGAACGGGACATCCTGTAC
ACGACAGTAAGCACCCCGAGCAGTATGCTCTGGGAGTGGCTATTAATGCCACAAGGGCTTAGTAACGCCTCTGCCACCGTCGATAGATGCGTCACAAATC
TGTTGAGACCGGTGCGAGACTTAGCACCGAGTTACTTCGACGATGTATTCGTCCATAGACGGGCTATGGGCGGAAATGCAGACGTAGAGGTTCATAGAAC
TCACGTTCGTCAGGTTCTTACACTTATGAGCAGAAATATCCAACCTCAAGAAGTGTATATTCGCTGCTAGCGAAATACCATTTCTTGGGTGCATCGTGGG
TAAACTCGGCGTACGCCCTGATCCTAAAAAAATTAGGACGATTATCGACCGGCCTGTGCTAGTCGACGTTAAGAGACTAAGAAAATTCTTTGGTCTAGCG
ACGTACTTACACAAGTAATCGCGCAACTACGCCAAGATGACCGTTCATCTCTCTCGTCTCTTGAAAAAAGAACGAGAAGTGGTCATGGAATTCTGATTGT
CAGCGTTCATTTAAGGTATCAAGCAGAGCTTGATGCAATCGCCAAGACGGCGATTGCAGACCAAGACAGACCATTCCATGTGGTCTGTCACGCCAGCGAT
TTTGCAATCGGCTGCGCGTTAATGCAGTACGATGCAGACGGCGCACAGCGTGTCGTCTGTTATCAATCGCGTCAGCTGCAAGCAGCTGAGCGTAATTATC
GAGTGCATGGAAAGAAACGCTTTGCCATGAAGTATACACTGGCGAAGTTTCGCGTCTATCTCCTTGGAGATAGGCCCGTTTGTAGTCTATACGGACCATG
CGTCATTACGCACGGCCGTAGACAGCCCCCACCTCTCGCAAAGGATGGCGAGGTGGCTGTCCTTCTTTGCGGAGTACAACTTTTCCGTGGAGTACAAACC
CGGACGACTTAATGTTGTCGCGCCACCCGATTTCGAGTCGGCTGCGCAGTCCAACAGTGGGGTTGATAAAACTGTTGCAACGCTAGTCACTAGTGTTCCG
TCGACAACATTGCTTGACGACATGAAAAAGTTCTATGCAGTAGATAAGGCTCTTCTGCGACTAATGGATCATCTGGTGACTCCATCTCGTAAATTTCTCA
AAAAATTATCGGCCTTGTATCGGTCTTCCGCGGGTCGATACACAACACGCAACGAGTTGCTGTATTATACGTCCGTTAACGGCAACACACCTCGTTTCGT
CGTCCCCACCCATAATGATTTGCTATTACGCATCATGTATGAGTGCCACAATGCACCAACTAGTGGGCATCGTGGGCGTGAGAAGACTTATCTCGCGGTA
AGTCACGACTTTTACTGGCCCCGCAGTATCAGTTTGTGCGCGA