Description :
From Genome Similarity Track
Location :
Scaffold_48:70953- 72487
Transcript NameFunction/comments
g9988.t1hypothetical protein

Sequence
1534 bases(100 bases per row)
GTGCAGCGCGACGACGTGCTCAAGGTTGTTCGCGGGACGTCGGTTCCTGCCGATGGCGTCGTTGTTTACGGCGAGGGCCGAATTGATGAATCGATGCTGA
CAGGGGAGTCCAAGGCAACCAAGAAAACAGTGGGCGACCGCGTGTTAGGGGCGACGTTGAACGTGGAGGGGCTGTTCCACATGAAAGTCACGGGCGTTGA
TAACGACACAGCTCTGAGCCAGATTATTCGTCTCGTGGAGGACGCCCAGACTTCCAAAGCTCCTATTCAAGCGTACGCCGACTACATTTCTTCCATCTTT
GTGCCCACAGTACTGGTGCTTGCGCTCGTGACTTTCGCAGCTTGGTACATCCTCTGCGCTTTGGATGCTGTTCCTGAAGATTGGATCCCAGATTCGGATG
GCAAGTTTGTGTTTGCGCTCGACTTTGCCATTGCGACGCTCGTCGTAGCTTGCCCCTGCGCTTTAGGATTGGCGACACCTACCGCGGTGATGGTTGGAAC
GGGTATTGGGGCAGAACATGGCGTCTTGATCAAGGGTGGCGAACCGCTGCAGGCTGCGCACAGCGTGGACACGATTATCTTCGACAAGACTGGAACCTTG
ACGGTGGGAAAACCTGTCGTGACGGATAGACTAGTCATTAGCCAGCAATTAAGCATCAACGAACTGATCTCTCTAGCTGGCTCAGCAGAACTTGGAAGCG
AACACCCTCTGGGCAAGGCCATTACCGAACACGCCAAGTCGATGACGTCGTCTCTTGAACAACCAACGCATTTTCGTGGGGTCTCGGGGCGAGGCATTTC
GTGTATGGTGGGCGAGCACGAAGTTGCTATTGGGAACAAGGAGTGGATGGCAGAAAATGGCTTGGAGCGGTTGGACAGCTTCGAAGTGGAACAGGCCACC
ACCAGCTTCCAAAATGCCGGCAAGACGTCTATATACGTGGGCGTAGACGGCGAACTAAGTGGTGTTTTTGCCGTAGCGGATGCTCCACGTGAGGAGGCAG
CTCGTACTCTAACGAAGCTCAGGGCGATTGGGTTGGATGTCTGGATGGTTACTGGAGATAATGCACGGACAGCGTTTACTATTGCTGAGCAGTTGGGCAT
CAGTCGGGACAATGTGATGGCCGAGGTGCTTCCGTCCCAGAAGTCGTTCAAGGTCAAGCAGCTGAAGGACATGGGCCGCGTCGTGGCTATGGTGGGTGAC
GGTATCAACGACGCTCCTGCTCTTGTCGAAGCAGACCTGGGCATTGCCATAGGAGGCGGCACCGAGATCGCCGTCGAATCGTCCGACATGGTGCTCATGA
AGTCGAATCTGTGGGACGTCACCACTGCGCTGCATTTATCGCGTACCATCTTCAACCGCATTCGGCTGAACTACGCGTGGGCATTCGGCTACAACTGTTT
GCTGATTCCACTGGCTGCCGGTGTGCTGTACCCCGTCGGCTTCAGCATTCCACCGATGTTCGCCAGTGCTGCCATGGCCATGTCGTCCGTGTCGGTGGTG
CTTTCCTCACTGTTGCTGGGGGTTTACAGTCCTC