Description :
From Genome Similarity Track
Location :
Scaffold_125:70941- 72539
Transcript NameFunction/comments
g14809.t1hypothetical protein

Sequence
1598 bases(100 bases per row)
CTCGGTACGTTGTCGACAACTTTATTCACGAAGCGAGGTGTTCCCTGCTAACATTTTGCTGGTATGATTGTAGGTGACGAACTTGGTCCCCGGGTGGGCG
AAATTTATCCGCTTCTCATGGAGCGTCTCAACAACGAAATCACGCGAGTGCAGACTATCAAGGCCATCGGAGTCATTGCTCGCTCCAAGCTCGATTTGGA
TATGTCCCCTATTCTGGTGGAGTGCACACAAACTCTGGCCCAGCTGCTTCGCCAGCAGTCTCGCACGTTGAAGCAAGCGACACTGGCTACCCTAAATGAT
CTGGTTGTGCGCAAGGGAGCTAGCATGCCGGAGTCTCTGCACTACGAAGTTGTCCAAGAAGCTTCGCTCCTTCTTGTCGACGTGGACCTTCAATTGTGCC
GCATGAGCATTACGCTGGTGTCAAACTCTCTCCGCGTGTGTCCGCACGTTGCTGCGACAGACGCTTTGCTGCAAAATGCTCAAGTGAAGGCACTGGAGCT
CTGTCATAGCTCCATGCTCCAGGGGCCTACTTTGGATGCACTGAAGGGATTCTTCGCGCAACTCACACAGTTGAACTCTCCGGGCAGCAGCTTCACCGAA
CTTTTCAAGGCGCTGATGGCGACACCTTTGGAAGAATCGAAACATTCTGTGCTTAACATCGCTCGGTGTGTTGCTGGTACATGTGTGGCTACAACTGAAA
CGAATCGCAAGGTGGCATTCGCTAAGTTTGTAGGTGACATCACGCAAACGGAGTCCGAAAAGAACAAAGTGCTTGCGCTATACTGCTTGGGCGAGTTCGG
CCGCAAGATCAAGCTTGCTGGGTATACCGACGTGAAGGAGACGATTCTAAAGTGCTTCAGTAATGCGGGCGAGGAAGTGAAGGCTGCGGCAGCGTACTCT
CTCGGTAGTATCTGCGTTGGCAACATGGAAGAGTACCTGGACACTATCATGGTTAAGTTGGAGATTGGAGAGAACTCTTACTTGCTGCTGACGTCGCTAC
GCGAAGTCATTTCGGACCACGCAGCTAAGCCTCACCACGGTTTTGCGCTGTATGTAGACCGCGTGCTGCCAGTTTTACAGAAGATGAGTGCTCGTCAAGA
AGAGGGGGTGCGCAATATGGTTGGCGAATGCATGGGGAAACTCGCCGTGACGGACAGTACAAAAATCATGCCCATTGTGACGGAACTTTGCGGATCATCT
GACGTATGGTCTCGTTGGACCGCCGTGACAAGTCTGAAGTATGCGATGACGACAACGGCGCAAGAGCCTGCGGTCAACGCGATCTTCGCTCACATCGACC
CTTTCTTGGCGGCGCTTGAAGACGAAGATTTGCACGTGCGCCGGGCTGCCCTGCTGGTGCTAAACACGGCGGCTCACCACCACGCGCACTATCTGGTGCC
GTACGTCCGTGAGCGCATCTTCTCAGTGCTCCTGAAGGCGACAGAAACTAAGTTGGAGCGAGTGGTTGACCTCGGTCCGTTCAAACACAAGGTGGATGAT
GGGCTTCCGCTCCGTAAGGCTGCGTACTCGTGTGTGGATACACTGATCCAGGTGCTACCGCAGCAGCTGGATATTTCGCTGTTCTTCGACCAGCTGAA