Description :
From Genome Similarity Track
Location :
contig_50:70936- 72543
Transcript NameFunction/comments
g8431.t1reverse transcriptase

Sequence
1607 bases(100 bases per row)
AGCGCGTCGGCCACGACATTCAACCTTCCACGTTTGTACTCAACCTGGAAGTTGTATTCAGCAAAGAATGACAGCCACCGTGCCATTCTTTGTGATATGT
GCGGCGACTTGATCGCCGTACGCAACGATGCGTGGTCGGTGTAGACCACGAATGGTCTACTCCCAAGTAGATACACTCGAACTTTGCGAGTGCATACTTC
ATGGCAAGGAGTTCCTTGTCATGTACCGGGTAATTGCGCGCAGCTGGCTTCAGCTGACGCGATTGGTAGTAAACACACGATCACGACCTTCGTGATCGAG
TTGCATCAGTGCGCATCCGATCGTGAAATCGGACGCGTCGCACACAACGTGGAATGGGCGATCTTGGTCGACCACCGCCAAGATCGGCGCCTCAGTCAAA
CCCGCTTGACTGCTTCGAAGGCCTGCTGACAATCAGCAGTCCATTCCCATGCAGCCTCTTTCTTTAAGAGCTGCGACAGCGGGCGAATCTTGCCCGCGTA
GTTGCTCACGTACTTGCACAAGTACGTGGCGAGTCCAAGGAACTGCCGCAGTTCTTGTACATTTGAAGGCGTAGGCCATTCATTGATCACTCTGACCTTT
CCTGGGTCAGGGCGTACGCCGTTCTTCCCCACGAGACACCCAAGTACGGGTATCTCGGTCGCCCCGAAGATACACTTCTTCAGGTTCGCATAGAGCTTGT
GCTTTCGCATGAGCTCAAGCAACTTGCGGAGATGCTCTGTATGCATCTTCACATTCGATCTCCCATTCACAGCCCGGCTGTGAATGAACACGTCATCGAA
ATAGCTCGGTGCGAAGTCGCGCACCGAGCGCAACAAGTGCGTGACGCACCTGTTGAACGTCGCTGGGGCGTTCATCAGCACCTGCGGCATTACGAGCCAC
TCCCAGAGCATGCCGCTCGGAGTGCTTACCGCTGTGAGAGGGATATCACTCTCACGCATGAAGATCTGATAGAACCCGTCTCTCAGATCCAGAGTACTGA
AGATAGTACTCGAGGTCATCGAATCGATGATCACATCGTTTCGAGGTATCGGCGTCTGCGCCGGTACCGCCGCATCGTTCAGCTTGTAATAAACATGAAC
GATGCGCCACCCGCCCTGTGGTTTCTTCACACAGAACGTAGGCGCGCTGTGCGGGGACTTCGATTCCCGCACTTGTCCTGCCTTGCGACGACTTTCAAAG
AAGTCGTCGATTGCCTTGACTTGCTCACGCGGCAGTGGCCACTGCCGCGTGACGCAATACTTCGTTCCCGGCACGAGATCAATCTCGTGCTGAACACCCT
TGTCCTGCGGTAACTCCGCAGGAATGTCGTCCGGGAGTACATCCTTGTACTCACGCAAGACCTTGTAAAAGGGGCTCGCCTTGAGCGAGTCCCAGCCTTG
CTCGTCGAAGCGTTCCTTCTTCGACTTCGCGCTGAGGGCGTCCGCGCCCTCACAGATGAGCTGATCCAGCTCTTCTGCTTCACACGTCATCCTCTCGACG
TCCTAGAGGATACAGATCTACTCTATGCGTCCATCGTGCAGGTCGCGAGCGAAACGCTTCCAGCTTGTGACTGGGAGCGACATCAACTCCGACACTAACG
TCGGAGG