Description :
From Genome Similarity Track
Location :
contig_93:70930- 72562
Transcript NameFunction/comments
g12695.t1hypothetical protein

Sequence
1632 bases(100 bases per row)
GGACGAGAAGCTCGTGTGGGTGCCGGCCACAGTCTTGTCCGTGGACGCGAGTGGCAAGGTCTTCCGCGTGCGCGTGGCCCGCGAGCAGGAGCAAGACGAG
CCCGCGGAGGAGCGCACCGTGGACCTGAACGACGACGGGATGCCCGACTCGCTGCCGCTGCAGAACTTGGCGGGCGAGGAAAACAACGGCAGCATCGGCG
CCGAGGATATGTGCGCGCTGGGCCACCTACACGAACCCGCGATCGTGTACAACGTGCGCGAGCGCTTCTACGCCCAGGAGCCGTACACGTACACGGGCAA
GATCGTGGTGGCCGTGAACCCGTACCAGTGGCTCAAGAAACTCTACTCGGAGGAGCTGCGCGACCAGTACACGCAGACGCCGTGGGACGAGATGCCGCCC
CACGTGTACGCAACGAGCGCCGAGGCCTTCCACCACATGAAGCAGCACCGCATGCCGCAGAGCATCTTGGTGAGCGGCGAGTCCGGCGCGGGCAAGACCG
AGACGGTCAAGATTATGATGGAGCATCTGGCCAGCATCTCCATGGGCATGGCCAAGCGCCTGCACCCCACGGAGAGCGGAGAGACGATTGTGGTGGAGAA
GGTGCTCAAGAGCAACCCGCTGCTGGAAGCCTTCGGAAACGCCAAGACCATCCGCAACGACAACTCGAGTCGCTTCGGAAAATTCACGCAGCTGCAGTTC
AATAACGAGCTCTGTCTTGTAGGTGCCGAGTGTCGCACTATTTGCTCGAGAAGTCGCGCGTGGTGGCGCAGGCAGCGGGCGAACGCAACTACCACATCTT
CTACCAACTTGTGAGCGCCAAGGAGGATATCTTTGGCTTCAGTGATGACTCGTCCGCGAGCGAGTTCAGGTACCTGCAGGACGAGAAACTCATTCTGGAC
GGCCAGACGGACCTTGAACGGTACCAGGTCACTCGTGATGCGCTGAGTACCATTGGGCTCAGCGACGAGGAGCAGAACCAGCTCTTCAGTGCTCTCTGCG
GTATCTTGCGTCTGGGCCAGCTCGACTTTGTTCCTTTGGAGTCAAACAAGGACGATGCCAGCCAGGCGGTTGCTTCGTTGAATGCGTCAGCGACTTCTGC
CCCTGTCACTGCGGAGCAGATTGAACAGCAGAAGATGGAAATCGAGCAGTGCGCGAAGCTGCTGGGTGTGGAAGTGACCGCGTTGAGCAAGCAGCTCTGC
AGCCGTACCGTCAAGGCGCGCCAGGAGGTGTACTGCGTCCCGCTGTCAGCTCTGCATGCCGGCAACAATCGTGACGCTTTAGCGAAGGAGATCTATGCGC
GAGTATTTGGCTACTTGGTGCGACGCGTGAACCACAGTATCTCGAACTCGGCGGACAGAGGCGCTTCGACGCCGTCATACTTGCATATCGACCTGCTGGA
TATCTTCGGCTTCGAGTCGTTCGAACACAACAGCTTCGAGCAGTTCTGCATTAACTTTGCGAACGAAAAACTGCAGCAGAAGTTCACGATGGATGTGTTT
AAGACGGTTCAGGAGGAGTACCAGCAAGAGGGCGTTGCCTGGGAATTCGTGAAGTACCGCGACAACCAAGACATGTTGGATCTACTGGAGAACTCGATGG
GCGTGATGGCACTGCTGAACGAAGAATGTGTG