Description :
From Genome Similarity Track
Location :
Scaffold_14:709053- 715715
Transcript NameFunction/comments
Phypa_INRA-310PPTG_08579callose synthase

Sequence
6662 bases(100 bases per row)
ATCTACGGCGCGCTGCCAGCAGGCGACTCGAACATCTGATAGTTCGAGTGCGACTTTGCACGCGAACGGCTAAAGTTTCTTGAACGCGCGCTGCCAGGCG
TACGAGCACTGCGACGAGAAGCGCGGATACGACGCAGACGAGCACGTTCGGCCTCCATCTCGCCCTTGGTGCAGACCATTCCATTCTTGAGCGTCCCCAC
TGTGAACAACAGCGCCGTCGCCACCACACAGCAGCCAGTCAACGTGAACAGGTACAAGTACTCGTCTCCACTCATCGACTCGCTGGAACGGATGAATGTG
GCGCACACAGGCAACAGGAAGAACACCATGAAGTAGACCGTCACGTACACGGCGCGCTGCTTGGTAGTGAACAGCCCGACACACGAGACCCAGGGCACTG
ACGTGATACCTAGACCGGCGAAGAAATAGAGCAACAAGCCGACAATCTGCAGCATCAGATACTCGCTGTCTCCCGTCACAAACTCCGACTTGTCGTTGAG
TCCCAAAACGAACACCAGCCCAGCCATAGGCAGCAACGTACAGAACAAGATGCGCTTGTGGTCGATACGATCCATGAAGAAGAACGAGAACAAGGCACCC
AGGAACTGCAGCCCCATACAGTTCACGAACATGTACGTGGCGTCTTCGATGCTGCGAAACGTGTCGGACAGGTACATGTTCACGCACCCCAGGAAGATAC
TGGACACGAGCATGAGGAACAATCCCATCACGAACTTGAGGAACGAAGTACCGCCGTTAGCACTCGAGTCGTCACTACCGGCCTCTTCGTCGCGGATCAT
ACGCAGCTCCTCGGACACGCCTTCCTTACGACGCAGTACAGCCAGACAGCGTTCACACGACTCCAAACCTTCGCGCATGTAGACCCAGTACGGACTCTCC
GGGAAGATGTAGACTGCTGGCGTCATGATCGACAAGATGATGGTCGCAATGAACACCTGCCACACCCAGCCCACTTCATTAGAAGACGACGAGAACCACG
CAGCGAACAGGATGCCGAGAATGAAGCCACTTCCAAGAAGCAGCAACGCTTTGCCACGCATGTCACGAGTGGAAATCTCGTAGATGTACACGGCCAAAGT
AGGCAGCAACACGCCCACAGAGCCTCCGAGTAAGCAGATACCAGGCATCAGGAAGCCTTCGCCACCAGACTGCACAGCACTGACGCCCAGCATACCCAGG
ACAGTCAGCAATCCACCAAGAACAATCGACAGTCGCCGTCCGATAAAGTAGTTCAGGAAACCAGCCACAAACGTGCCCACCATACACGCGAAGTAGAAGG
CGTACGTGACCGAGCCATCGCCCACGTTACCGTCCAGTAGATCGTACGTCGTGACGTAACTCAAGAAGCCAGCAGTGCTCTCCAGAGTGGTGAATAAGTG
GAACAACCAACCACATCCCATGCCTCCCAGCACACCCATGAACGCAGCCAAGGAGAACGCGTACTGCGACGAAGCCGACACGACCTCCGAGAAGCCCTTG
TTGTACATCATACGCGTCTGGATGATGTTCAAGAACGGGATCGCCGACATGACTAGCAGCGGGATGATCATGGCCACGGAGAACACAAAGTCGAAGAAGA
ACGCCAGCTGCTGGAACATGCCCACGGTGGCGATCGACGAGTTGGCAAAGCTGTACATACGCGCCATCTCATTGATGCCGTACAGCGCCGCCATGTAGCC
AAAGAACAGCGAGATGGTTCGTGTGAAGCTCACGTCGAAGATGGCAATAGTCAGCACGAAGAACACGATAACGGCCAGCACCACTACGAACGTGTAGATA
ATCGCACGCACTGACGACTTGACACTGCGCATGCAGCTTCCCGCCGCTCCAAAGAGTCCCATGGCCAGCACGGTGACCACGGCCGCACCGAACACCAGTC
CAACCGTGAGGATCTCCCACTCCAGAGCCACCACGTACCACATGAGCAGGAAGTGGCGGCATTCGCGGAGAATCACAGTGAGACGAGCAATAGGCCTCGT
GTTGTGGTACAGCTTGAGCTCTCCTTTCCACCAGCCAATCCATCCGCCCACCATCACCTTGTCTTCGTCCTGGTAGTCCTCAGCAGCGTACATCCACTTG
GCCCAGGCCGTCACATCCGCCTTTGTCTTCTCCCAGTCCAGTCCGTCCGTGTTGAAGATGTACGGAGACACCAGCCACACCACAGCGATCACCCAGATAG
CAAACGTCTGCACGCCAAAGCTCTGCGACGTCTGGCAGTACTCGAACGCGAACGAGTTCTCTTCTCCGGCCACGTCAAGGTCACAAATGTTGAATTGGCC
GAACGCCAAGTACACCAGACACAAGCCAATCAACTCCATAGCCTTACGGTAGTGACTGGGCGCGTACGCCTTGTACAGCAGCACGAACGTCTCTCTTGTG
ATCTTGAATCCTCGTCCTGTAGCCTTGTACTGCGCCTCACCGTGCAACAAATTGTTATCGAAGAAGTGCATCGTTGTACCGAGTTGGAAGATAAAGAACG
CAGGTCCAGCAGTGAACACCATCTCCAAGAACTGCACGAGACCGCGACGTAGACCCATTTCGGCGAAGTAAACGCAGATCAGAGGCAGCGATAGGAACAG
ACCGGCTTGGATATAGTACTGAGTGTTGTAAATCGAGTCCATGTCCTTGTACACGCGGTCATCGAAGCCGTAAGTCTCGGAGTTGTCCATGATCACGTCC
GTCGTGTTCATGTTGTACACGATCTGCGTCTGCACTCCAGACAACGCGATGTACACCTTGCAGTACATGTATACAAACGTTGTAACAATCGTCATCCAGG
TCGCGTAGTAGAAGCCCGTGTGCGAGTAATACATCGAGTTGAGTCGGAAAAAGTCCATGAACTGCCCCATACGATGCGCCTCACGTGCCAGCGACGTTTC
TCCGGCACCGTTGGCCAATTTACCTTCAAACATGGAGATCTGGGATAGCGCCACGTCACGTCCTTTACCACACTGCATGAACTCAACGTGGGTGACTACA
CCGCCACGAAGAGTACAGTTGAAACCAGCGAACACATCTTCAGACAAGTTAATACCCTTGGAGGCCTTGGACACTCCGCCGCGCGTGATAGCCAACACTT
TATCGAACACATCCGGGTGACCATAGTGCATACGCACGTACAGCGGATCAGCCAGTACACGCTGCGACAGCGTCACGAACACAAGCTCCTGCCACGTTTT
AAACTTGGCAAGAGAACTGGCATTACCCGTGAAAATGTGTTCACGCATGCCAATAATCGAGACGGGTTTCTTGGACGGGTGCAAGTCAGCAGTGCACAGC
AGCTGGGGCATCTTTAAGCACTCTTCGAAGTAGTGTTGCTGGTTCATATCGATCGTCTGCACGAACTCTCCGCGTGTGAACGGGATGGCATTGTTCTGGT
TCTCAGGCTTACCTTCTCCCAAGATAGGGTCGCCAGGAAGAGAGTAGCGGTACACTTCGACGATCTCGTCGGCTTCGCTCTTGATCAGCACCGTATCGAA
CGATTTCTCGCCGTCTTCGTGCTCCACCGTGTCCACATAAGCCACACGTAAGTTCGGGTATTCGCGCAACAAGTAGTCGATGTCAGCAGCTTGCGCTTTG
CCCTCTGCGCGGTGCTTCCCGTACACTTGACAGGCGCAAATGTACGAGAACTTCAGGCGCACCATATCTTGCAACTGGCTCTGCTTCTGCTCCGCCGTCT
TGCCCGGACTCGAGCCAATCTCCAGCCAGTGGAGGATCTTGATAGCGTCCTCGTACATCATCATACCCTGCACAGTACGCGCCAACGTCTGGCCACGGTA
CGAGGCCCACAGACGGATTTCTTCCGGGTGGTTCTTTTGCGCTTCCTCAGCCGAACTCACGTCCACACGCTCCAAGAAATTATCCCATTCTTCTTGATGG
ATTTTCGTCAGATATTTCAGAATCGTCAAGTTTTTGCCGTCCTCCTCTACTTGCTGGAAAATCGGGTGGTTAACCAGCGGATCGTTCAGATCTTTGAGCG
AGAACAATACCGTCTCAGCGTAGAATGGCGTGACGACCGAGAAGCTGCGCATTTCCTTGATAGAACGCAGTTGAGGGATGTCCATGACCAGCGACTTCAT
AAAGAAGCCAAGACGACGCTGCGCTTCAGTCGTACGCGGCATGGCCTCTGACCGGTCCAGAGACAGCAACAAACAGGCTCGTGTAGCCGCTCCCATGGCC
GTATCACTGCAGAACAAGTTGACGAGGCCACGAGAAGCAAAAATGTAGCCATTTGCACTAGAACAGAACTTCGAGTTGCTGAACTTGCGTTGCAGAGCCG
GATCCACACAGAACGACTGCACTCCGTTCAAAAAGGCCTCCATCTTGGACACAAAGTTGCGAATCACGCCCATAGAGTGCACACGAGCATCCGGAATGTG
TTGAGACTGCACATCTGGGTCTGGCAGGTCCAGAATCTCCTCCAAAAGGTCCACAGCGGCCACACGAAGACTGGCAAGTTCACGGACGTTGAACGACTTG
AGGAACCCTCCACTGGACGCGACCTCCTCCATCATACGGAATCCGTCAACCACGTCGGCGTCGTCATTGCCGAACAACGCGCTGATCACGTACATACTAG
CAGTAAAGAACGAACGGATAGCCGAGAGACAATCATTCTCCACCAAAGTGACACGCAGTTGCGACTCTCCTTTGCCGTCTTTTGCCGTCTTGATAGCCAG
CCCCATCGCCTCCGTCAACTTACCAGCAGACAGGAACACTGGCTCGAATACTTCGCCAGTGCTACGGATATCGTACTGCAGGATAGCAGCCTCTTTATCG
TCCAATAGATCGCCTTCACGGAAGGAATTGACGATCTCATTCCACACTACGACGAAGCGGAGCATCATCTGAGACTCGTAGGCTGCAGCTAGAGCACTGG
CTCGAGTCGAGTCGGTACCGCTAGCAGTGGCATCACTGGACCGCGCAAGAAGCGTGACAACCTTCTGGTCGAACAACTGAGGAGCGACACGGAACGCCTT
GGTCATCTCCTTCGCACCACGGATCTCTCCCGTCTTCATGAGAATTCCCTGGAATCCACCGAGTAGAGCTTGGAAAATCGTAAAGTAAATCTGCGTGGCG
TAGTTGAAAATAAACACCACGGGCAGCCACAGGGCGATGATAATGCCAATGTTGTGGAACGACACCAACGAGTTCTGGTAGTCCAGCGTCATGGCGTAGA
TACTCAACGTCGGTAGAATCAACGGACGCACCAGGATAAAGTACGACGTGATGGCTTCAACGATCCACAAAAGCAGCCAGAACGCGATGTACTTGACTTG
GAACGAGAAGGGAGGCGTCATGTCTTGACCGACATAGCAACTTTCCCCCTCACGCACAAACTTAGCGGCAAATGTGCCATTGATAACTTGAGGTGCAAAC
GCCTGGGTCAAGAGCACCAGCAACCCAGGAAGGATGTACGCACCACACAATGGGTACAAATTATCCAGCAACGTCGTGTCCTTGTCCTCGTTCAGTGGCA
CGTAGATCATGATACCGAACAACACGGCAAAGCCTCCGTTCCAGAGGATACGAGTAGCTAACGCCGTGCCATAAGTGAAGGAACGCGAACTAGTTGCCGA
ACTTTCCTTGGAAATCAACAAATGCCAGCCGTGGCAAACTTCCATGACACATTTGAGAAATGCCATCAAACTCAAACTGAACGGAATGGCAACAACGGCA
ATTTTCAAGTCGCGGGTTGTGTAGGGCTCCACCACGTCGCCAATGCGACCGAACTGAACCCATCCACTTTTGCCACCATCCGGGGAGATAGTGACGGCAA
ATGCCAAAACCGTCAAAAGCACCAGAAACATCATGTTGAACTGGAAAATCCGGTAGTAATTGAGCACCAACGTGAGGAAACTGCGGTGTTCGTAGAACGT
CTTGCCGTGGTTTTGCGTCAGTTCCTGGCCCACGTGCGTCACTGGGATACTAAGACAATGCTGCTTCCAGAAATACTCGTTAATGTCGTCGTAGTTGCGG
ATTTTCACATGTTCCAAGGGTTTTCCAAGTGCGTTGCGACGCTTCATGTTGCTGGCCTCGCGCCAAATGGGGCGGATCACTTGGTCCAAGTACCAGCCCT
CGGGCTGCTGCTCGTGGCCCTGCGGGTCGGCGTTGACCATTGTCAGCATCTGATGGTGCAAATAGCACACACACTCTGGAATGTGACGCACGTTTGCCGC
TTCTCCCCAAATGAGGAAGTAAAGCATCACATCCATGTGCAAATTACCAGAAGGCGTAGAGTGCGGAATGCCACTCCCAGTATACGTCACTGGACTCGTG
TGGATAAATTTGCACCACGACCTGTAGTTGCTAAACAGCTTATTGGCCAGTTGCACGAGGTGCTGGTCTGCCGGGTCACTTGGCAAGCAACGCGCCTTGC
CATTGGCCAAAAGGAGCAACACGTGCTCGCGCTGGTTGCTCACGGATCCCTCCTGGAAGCCAAACTTGGCCTTGAGGAACTCGCAGCAGTAGTCCACGGC
GGCCTCGTCGTCCTGTGCAGCTCCCTTGAAGCTCGCAGGCGTCACGTCCATCGTATTGAGGCGTTTACTGAAGCGCTCCGACCGCTCCGACTTGTTGCGG
CGCCGATCGGCGTCCAGCTCGAAGTAGTTGGAGCTGGCGCGCCGACGTCGGTCCATCTCGCC