Description :
From Genome Similarity Track
Location :
Scaffold_2755:709- 2831
Transcript NameFunction/comments
Phyta_totarag14802heat shock protein 101

Sequence
2122 bases(100 bases per row)
AACGTATCCCGGTGGAGAGCCAATGAGTCGCGAGACGGTGTACTCCTCCATGTACTCGCTCATATCGATACGCACCAtgtgcttgtcgtcgtcgaaaaGC
TCGTTCGCGAGTGCCTtcgccagctccgtcttgccGACACCAGTGGGGCCTAGGAAAAGGAAGCTACCGGTCGGCTGTCCCGTGCGAGCAAGTCCGGCAC
GCGAACGGAGCACAGCGTCGCACACGACTTTCACTGCGTCCTCTTGGCCGATCACACGCTTGTGGATGCGCTCTTCCAGATGCATGAGACGGTCGCCCAT
ACTCGACGTCAGGCGGGACACCGGGATGCCCGTCCAACGAGCCACCACCTCGCAGATCTGGTCTTCTCGCACGACCTCCTCGACCATCTTGTGCTGCGTc
acatcttcatcctcgcgcttcttggctgccTCTGCGACGGCGATGCGGCGTTTGACGTCGGGGATGGCATAGTACTGCAGATCAGATGCGGTCTGCAGGT
CTTGGTTGCGCTCAGCCTGCTCAGCCTTCAattgcaggtgctgcagcttgtcgcgGAGCTGGCGGATTTCGTTCACACGGGCCTTCTCCGCCTCATGACG
CAGGATCAGCGGACTCAGCTCGTCTTGGATTTTGTTTAGCTCCCCCTGCACCGTTTTCAGACGCTGCTTGCTCATTGcatccttctccttcgcaaGAGCA
GTAGCCTCGAcctgcaactgcagctgccggCGCTCTAGTTCGTCGATGACTTCAGGCTGGCTGTCCAACTGAACACGAACGTTTGCGCACGCTTCATCGA
TGATGTCGATGGCCTTGTCTGGCATGAATCTCTCCTTGATGTAGCGGTCAGCAagcttggcagcagcgacaagagCCCCATCCATGATCTGCACACCGTG
GTGCGACTCGTATCGCTCCTTCAGGCCTCGCAGAATGCTCACCGTGTCCGGCACAGACGgctccttcaccagcacctgctggaaACGACGCTCGAACgcc
ttgtccttctccacaTGTTCGCGgtactcgtccagcgtcgtcgcACCAATGCAACGCAGCTCACCTCGCGCAAGCATAGGCTTCAGCAGGTTCGCAGCGT
CCATCGCGCCCGACGTCTGGCCAGCACCGAGAATCAGGTGCATCTCATCGATGAACAGGATGATCttgccgtcgctgtccttcacctccttcagCACAGC
CTTCAGACGCTCTTCAAACTCGCCGCGGTACTTGGCGCCAGCGATGAGAGCGCCCATATCCAGGCTGATCAACTTGCAGTTCAGCGAATCGGGCACATCG
CCCACTACGATCCGCCGCGCCAGGCCTTCCACGATAGCAGTCTTGCCCACGCCAGGCTCGCCGATCAGCACTGGGTTGTTCTTGGTTCGTCGCGACAGGA
TGCGGATCACTCGTCGAATCTCCTCGTCTCGGCCGATAACCGGGTCGATCTTGCCCGCCTCGGCCAGCTCGATCAGGTTCTGGCCGTACTTGTTCAGGGC
GTCGTAGTTCTCCTCCGCTGACGCACTCGTGACGGGCCGACCGCCGCGCATCTTCTGCACTGCGTCCTTCACTTGGTTCTCGTCCATCTGGTTGCTCTTG
AGCAGGCCAGCGAGCTGCGAGTTGTAGTACAGGGCCACGACGAGGTGGTCCGCTGCCAGGTGTGTGTCCTTCATGTCCTTGCGCATCTTGTGCgcgtact
tgagcagcttcatgagcgCCGAGTCGGCGCCGATGGAGTCGGGCGCCGGCGTCTGCTTgggcagcttcttgagctgcagcatcacgTCCTGCTGGAAGCC
GGCCACGTTGCCGTGCACCAGGTCGGCCACGCGCTTGGCCGTGCcgttgttgtcgtcgaaCAGCGCGTAGGCCACATGCAGCGGCGTGAGCTGCGTGTGG
CCGAACTCCTCCGCCATGCCCTGCGCATTGCGCAGGTATTCGTTGGTCTTGTCCGTGAATTCTGCCGGATTCATCTGTCTGtgtatgtgtgtgtgtgtgt
gtgttgtggGTGAATATTCACTTGTGGCTTTAAAAGCAGATTCAATAATGGCCAACTTGGTCAGACCAAGTACAGTACCCGCATCACTGCCGATagatac
tacatgtatctatTAGATAGAC