Description :
From Genome Similarity Track
Location :
Scaffold_2465:709- 2311
Sequence
1602 bases(100 bases per row)
CTATCACGCTAGCTTGGAAGGCGGACATCAGGGTATTGGTCGGACCTACCAACGGGTCCGGGAATGTTTTCACTGAAGGGGACTATTCAAGAGCGTACAA
CGATACGTCGGTGAATGTGTGGATTGTGAGACGGGCAAGGGCAGGCCCACAATCGAAGGGGAGTCACCTGGAAATATCAAGCGACTTACCCTTTCCAAAT
CATAGCCATGGATCATATCCCCTCGTTGCCCAAGTCGTTCAAAGGAAACACAGAATTGTTGATTTGGGTGGACCTGTTTACCGGATACGTGGTAGCCAAA
GCTATTGCGTCTAGAACTGCGCAGACCATTGCTGAATCATACGAGGAGTGCGTTTTTCGAAGATTTGGAGCTAGCGAGATGATTAGACATGATCGGAAGC
CAGGCTTTATGTCCGATTTCTTTTGAGCATTCAACCGGATCCTGGGGCAGCGACAGCGAGCAACCATGGCATATCGTCCCCAAGCTAACGGGTCGGCCGA
GCGCATGGTACAGACGATCACAAGAGCACTCAAGATGTACGTCCAGGATTTGGATCAGAGGGATTGGGATGAGTACGCAGAACGGCTCCCCTTCGCGATG
AACACCGCCCAAGACAGGATCCGGGGTGATACCCCATTTTACTTGGTACATGGGTGGGATCCCAAATCCACCCTAGAAGCGGCCATTCCGGTATGCAGCA
CCAAGAAGAGAAACCGAGATCCAAGGCGATGGCGATACCAAGTCCAGAAATACTACCAGCAAGCTAGATCCCTAGGTGAACGAAACGACTGCGGAGTGCG
ATACAGGATCGAAGCGGATCGACACAACGAAGACGCCCGTCCACATCAAATCCAAGTGGGATCGCAAGTGTGGCTTTATTTGGATCGAGTGAAAGAAGGG
TACGCCCGCAAATTGGCCCATCTATGGCATGGACCGTTCCGAGTGAGCGAGAAGATCGGAGAACATGCGGTAAAGCTGGAAACGGCAGGTACCGAATATC
GCCTGTTCCCTGTAGTACACGTATCCAAGCTGAAGTTGGTCAAAGAATATCCGGATCAACCGCAGATCCGTCTCTCGGTGGATAAATCCGACCGGGTGGA
TTTCGACGAAGTTCTCCTACCGGAAGATAGTTGAAATGTGGATCTCGAAGCCGACGAGTTCGAAGTCGAGAAGATCACCGATATGAGGTCGGGGAAGCGA
ACTAGATACGGACGGAGTTACCGTGAATTTCTGGTGTATTGGCGTGGATATGACGAACCCAGTTGGGTAGATGAGGCAGATCTGAACTGTGGAGCATTAC
TCTATGATTTCTTGCGGGATCGTACGAATCGTAACAGATTTGGCGTGATGCAGTCTCATGAAGAAGAGTAGGAGGGGGATCCATGGATGTGAGTTGGTCA
TGTCGATGGGAGGATGAAGAAGGACCCACAGGAAGGGTGTGGGCCAGGAGGAGGAGGATCGCTGATGTGAGTTGGTCACATCGAAAAGAAAGAGAAGACG
AATCTACAGGAAAAGCGTGGATTAAGAGGAAGGAGTGAATGTTTATGCATAAAGAGTGACGTTTTACGTGCGAAGGGGCCCGCTTGATTTCAAGCGCTAG
CT