Description :
From Genome Similarity Track
Location :
Scaffold_1243:7088- 8505
Transcript NameFunction/comments
Phyta_totarag12505hypothetical protein

Sequence
1417 bases(100 bases per row)
TGTTCGATCATCGAAGATCTCCAAGACCTCGCTCTCACCAGCCAATCGGTCTGGTTCCCAACTATCTTCAGGCAATCGTTCTTCGTCGAAGCCAAAACGC
GAGGCCTCAGTCACATATTGCGTCAACCGAGTCTTCGGTCTGTCCTCAATTCATTTACCGCCTTGCGGCGCGACACATGCACCACTGGGTAGAAGTGGTA
GCCACTCTTGTCAGTCAATTCCAGCTTATAGGCGTACTCTTCCACCTTTTCCTTGACACGGAAAGGACCATGCGATCGGTGGACCAGTTTCTTGATCAAA
CCAGGCTTGACTCGCTCCATGTACAGCCAGACTCGACTTCCAGGCTCAAAGAGATCTTTCGCCATTGCTTCAGTAGGTTCGTCATTGGTGTGTTTGGCAT
TTTGGGGCTCGATCGCAGCCTCATCGCTCGGTTGTCGAGGCACAGCTGCCCGCTCCTTCCGACTCAAGGCCTCATTGTGTTCCTTGGCTCAGCGAGCTTC
TCAGCGGCTTGGTATTCCTTGGCCATCTTGAGAGCTATCTCATGTTGACGGTTGACTTCACGGTGCCACGCGAGTGCATCTGATTGATTACCAGATCCTC
ACCGAAGTGACAACGTCATTGCTTGCAACGTGGAGTGAGCGTCTCATCCATGTACCAGGTAGAACGGGGTTTCTTTTCGCGTCGTGTCCTGAGCGTTGTT
GATCGCAAACACCAGTCGTTCTGCGATCTCGTTCCAGTCCTGCTGCATCGGAACTTCGACGTACACCTTCACGGATTGCATGACCGTCTTTACCGACCTT
TCCTGCTGTCCATTAGCTTGAGGGCGGTAGCTCAGCGTCGCTCTTGACCTTGACTGCATCATTTCGGTAAAGACTTGGAAGATCTCGCTCATAATGCGGG
GATCTCGGTCGTGTCGAATGAGCGACAGTGCCTTAAAGTGTCGGTATACATTCTTCGAACGCTTGAGCCACCACGAAAGTAGACGTATCTGACATGACCT
TCGCGATGACGAATCCAGTGAACGGGCAttcaaacagcaacagcgccgTGTTACCGCGTCAAGACTTCGGTAATGGTATAATAATATCCATGGACACTAT
TTGGAATAGTCATTCGGCAAGAATACTGCCAGGCGAGTATCCCGGGAGCTATGGTTGACTCTTGCTCGAACTGCAGTCAGGGCACGACTTCACatgcttc
tccacgtcggcGTAAAGACCTAGTCAGTAGTAATTCAGCTTTACCCGTCGGTACATTCGAACTACATCTTGGTGTCCGCCTTCCAACGAGTCGTGACAGT
TCTGCAACACTTCTTGAATCATCGTTGCGGGCACCTCTAAGTGTAGCTTGATGTCCTCGGCTTGTTCATCGCTCTTCCGCCGGCATGGTTGCCACGAAGT
AGAGCAATCCGTCGTCT