Description :
From Genome Similarity Track
Location :
Scaffold_112:70866- 72274
Sequence
1408 bases(100 bases per row)
CACTTCCTCGACCTTGGTGTAAGGTACACCAATGGCTACATACATTTACGACCACCATGACGGGTGGTCCATAGAGACTTAGGATTCCTATTGGCTGAGA
GAAGCATCTTTTAGCCAATGAATGACTTGTATATTAGCAGAATCCTGCCAATCAGCCGTTGGCAGATTCCTAGTTTAGAATATTACATTTTGAGGAAGTC
AGAAACATAAAACAAAAATAGCAGTTCTCAGCTTTTACCAAAACCCGCTACTTGGAGTCTTTATCTGGTTTAAAGTATACTCGTGGATCTCGACTATACT
TAACTCAAGTAAAAGAAACCTACGCTTCCTCATACACGTGCGCATACGTGTAAGCCGTAGTAGTGAGCTAAGGTAGGCCCACTACACCTGGTAGCACTTT
GTAGTCCGTCCAACGACCGACTACCTGAACGTTCGTACGGAGCTGTACGAGGAGCCGAGAACCTTTTCATGAGCGCGGAGGTGCCCATGGAAAGCTCCAC
TTCGCCTGCAACTCATGTTGCACGCGCTAACTGCCTCCACCTGTCGGATCCAGAGTGGGAGGCACTCCAACGACTGTCAACAGTCATTGGAGAAGCGGCT
GTAGCTGTAATGCTGCGCACACTATCGCCGACGGAGCAACACGGTGTTGCTCTGGGATTCATCATGAAGGAGCAGCGTGATGCTGCTTCCTCTATCACGT
TGGCGTCGGGGCCGACACCGCGCGAGCAAACGTTGAAGCTAAGCGTGAGCAACTATGTCGGAAGAGAGGGTGAACCTCTCCTCCGTGGCTTGTCGAACTC
GACACCGCCATTGCGGCTCGACGTATCGTCGACCCGTTGTCGAAGGTTGCGTTCGCCATGTCATGCCTTGGCGGACGTGCAAGAAGTTGGGCGTATGGAC
GCCGACTCTCGGATCCTACGTGCTTTAGCACGTACGAGGGTTTCAAGGAAGAGCTCAGACAAGCGTTTGAGCCCCCGCAAAATGTTCGGTCGAGGGCAGA
GTTCCTCGACCTACAGCAGGGTAAGCATGATGTCCATGCTTACGCTCAGAGAGCGCAGTACTTGGTCTCGAACATTTTGACCAATCCGATCGACGAGGCG
ACCAAGGTCGTCACGTTCATGAAGGGACTGACAGATGGGCCTGTGAAGACCTACCTCTTCCGTGAGTACCCGAGTACTCTCGAAGCTGCAATTACTCTTG
CAATGCAGGAGGAGTTTAGCCTGCGGCAGGCTAAACTGCATGCACATGTGCCGAGGCCACAGCCACGCCCGGTAGTGAGGACGGGAGGCCCAGAACCCAT
GGACCTCTCGAGTGCTGCAACCGCTGGACCCCAGCAGTCACAGGGAAACAATGTGCGATGCTACCGTTGCGGTAGAGTCGGTCACTTTGCTCGGGAGTGC
ACGGTCCC