Description :
From Genome Similarity Track
Location :
Scaffold_849:7086- 9141
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_849-snap-gene-0.11Conserved gene of unknown function
Pytiw_DAOMBR242034maker-piw_contig_849-snap-gene-0.16Conserved hypothetical protein

Sequence
2055 bases(100 bases per row)
CGGCCGCCAGGAGCTCTTCAAGCTGCAGTTCCTGCGCGAGACGCGCAAACACCATCAGTGCATCTGCGAGGCAGCGTGTGCGGCGACCAGTTCAATGTCT
GCCGCTGCGGCGTCCGCACTGCTGCTGGCGCAGCACGACGTGTTGTCAATGAACCGCGGCGGCGGATCTACAGCGAACGACCCAACGCTCGAGCAAAGCA
GCAGCGACACGGAAGCCGAGCGGAGGGTTAAAGCTCAGCTCAAGCAGCTACGCTCGTCCAGCGAGTCGAGCCAGACGCACATCTGGAACGGACTCAAGAA
CCTGTACACCCCGCCAGACGTGACGACAGGGGTCATCTGCGACGTGTGCTTTGCCTTCAGGAGCGCGTCGCTCGTACTTGATTTGCCATCTCCATGGCAG
GAGTTCACATGTGAGAACGAGCCAAGCAAACACTATTATTACCACCCACAGACCAGGAAGGTACTCTGGCGCCCGCCGGTCGACACGGGCGTGCTTAGTC
TGCTCGTCTTCGAACGCACCAACTCAGTGTTCACTGTGTGCCACTGCAAGCCCTCGCGCGAGCGCCGACGCCGGCTGATGCAGAATTTCCGAGACCACGC
GCTGCAGACCGCGGCCGCCGAGAGCGCGAAGAGAGATCGACAGCTACGTGGGGCCTTCAGCTCACTCGCGATCTCCATACTCAAGATAAAGCCCCAGTAA
GACGCGTTATATGAAGTGGTTACGCTCAATTGTCTTCGCGCTTGAAGTGCTGGTGCATCTTGCCGTCGAGGAAGTTCTTGAACTGCTTGCGCTCGTCGCA
CGAGAACCACATGCTCATGACGTAGCGCGTACCGCTCTCGACCTTGCGCACCTGGTGCAAGTTCTCTTTGCCCGCAGTAAACATCATGAGTCGTCCGCGC
GCAGGCTCGACGACCGACTCGCTCTTTTTGTCCAGGAATGCAAAGAGACCACCAGTGAACTCGACGTCGTAGTCTGACAAATACAGCAGTCCCGAGTAGT
CGTAGTGGTGCGTGTTGTCCTTGTCCACATGCGGGTGCCTATGCAGCGCAACACACTTACAAGGTGAGCTATCTCTTGAGTCAGGTGGGCTTGTGCGTGT
GGTGCTTACCAGTACTCGTCGTGCATCTCGGTCGGGCTCCACGACGCATTGCCTACCAGTCGCGTGATGAACGTGGGCGCCGTGAAGTAGAGGAACTCGA
GCTTGAACTCCTCCACCAGCGCCAAGCGGATCTTCTCAATTACTCTGAGAATCATAACAACAACAGCATCTTCTATCAGGTTGGTGCAGCATTCTATGGG
ACACGAGCGAGCAACCATACCGTCGGTAGAGAGTAAACTGCTCGGCCGTAAAGCGTGGAATCGCTGGCGAATTGCGGTCCTTCTGGTAGATGTTGACGAG
CCCTTGGCCGTCCTTCACGTAGCCCGTGTTCACGTCCATGATCGTCGGACCGCCGAGCCTGGAGCGGTTCGCCATGCCCGTCTCCGCGATCGCACGCAGC
TCAATCACTTCCTGCGGCGTCACAAAGTTGTCCTTAACGGCACGTCCGCACGCCTTGCCTATCTTGTGGCAGCCCTCAACAAAGCCCTTGGCCGATTTCT
AAAGAGGTAAGTACAACAATGAAGCGTCAGAGGATAGATCGGACGCCGCTATAGAGAGCACGCTTGTCTCTGTACCTTCTTGACGTAGCATGGGATATCG
ACGCGTCGGCGCTCCACGACCTCAGTGCGTGAGAGGTAGCTCCCACCGCGCTGCTTCGCCTTGGCAGCCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCAGGTACAGGCGGTTGACTGCGAAGAAG
AGGACGAACGCGACCACCAAGAACGGCAGGATCGTCGCCGCCATGTTCTTGACCG