Description :
From Genome Similarity Track
Location :
Scaffold_81:70852- 73045
Sequence
2193 bases(100 bases per row)
GAAGCTAGTTGTTCGCAGCCTCGTTGGCACAGATAATGAAAAAAAGAGCAGCGGCAGTGCTAGGTCGGGTGCAGAGCATTGGTTGAAGTTGGTGAGGGGT
ATGGCGATGATGAGACGGGTGAGAAGGAGAGAAGACAGGTAGCAAAGGATGCTGCCTGGTCCGTCGCGGTATATGTTGTGTAGTCGCTTGTTTATGGTGG
ATGTGTTGATTGACTGAAATGGATTGTATTTCTAACGACAGCTTGGCCGAGTGGTTAAGGCGATAGACTAGAAATCTATTGGGGTAACCCGCGTGAGTTC
AAATCTCACAGCTGTCGGGTCCATATTGCCTTGCGTTTTGGTATCATCACCTTTTCGACATCACTGCCTTTCACGTCGCTGTTGGTGCCTCCCTTGGTCT
TCATGTACGTGAAGTGCTGCTGCTGCGTCTGTCCACCCCAACCGATTTCAAGATAACGCTTTCTATGACCACAGCTCGGTCCTATGCATTCGTCGATATT
TTACTACTGAAGGGACGCCGTATGCGCCCTTGTTTGTGTATGGACCGCACCTGAGACGCAAGCATGCGCCAGTAGCCAAATGGACTCTGGTTTGAGTAAC
TATCGCGCCTCGACATGGCGTAACTAGAAGTACACCCGATCCGTAGCTGAGGTGGGCCGGCGGTTGCCACGCTGTGATGGTTGGGGTCTCCCGATGCGGC
GAGGGGCTGGCGTGGGGGCGCGCATAGGATGCCAGGACAAGTGGTGTCGGAAAGGAGAGAGGCGCAGGTGTGTGCGCCAAATTTGTGATGCGATGGGTGT
GTTCAGTGTGGAGCGTCGGTGTCGTCTAGTGGTTAGGACGTGAGCTTAACACGCTCAAGATCGAGGGTTCGATCCCGTCCACACAGAGCCACTTTTCGAG
ACGCCTGCACATGCTGCCGCCATTCCTCCTCCTGCTATCGCGTCGTGGTCGAACGGTAGCGCGGTGCTGTCGACGAAGCTAGTTGTTCGCAGCCTCGTTG
GCACAGATAATGAAAAAAAGAGCAGCGGCAGTGCTAGGTCGGGTGCAGAGCATTGGTTGAAGTTGGTGAGGGGTATGGCGATGATGAGACGGGTGAGAAG
GAGAGAAGACAGGTAGCAAAGGATGCTGCCTGGTCCGTCGCGGTATATGTTGTGTAGTCGCTTGTTTATAGTAAATGTGTTGATTGACTAAAATGGATTG
TATTTCTAACGACAGCTTGGCCGAGTGGTTAAGGCGATAGACTAGAAATCTATTGGGGTAACCCGCGTGAGTTCAAATCTCACAGCTGTCGGGTCCATAT
TGCCTTGCGTTTTGGTATCATCACCTTTTCGACATCACTGCCTTTCACGTCGCTGTTGGTGCGTGTTTTAACGTTTCACATCATTTCATCCATTACAAAG
TCGTGCTTCGCCTGAAGAAACTCTGAAACTAAACCCCCCAAGCCCGGATACCGGTATTAGAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN