Description :
From Genome Similarity Track
Location :
Scaffold_56:70846- 72301
Transcript NameFunction/comments
Phyin_T30-4PITG_17760Amino Acid/Auxin Permease (AAAP) Family

Sequence
1455 bases(100 bases per row)
CTCTCTTCACGCTTGAGGATGCGAAGATCGCTTTCAACATTTTTTGCTGTATCTGCGGAATCGGCTCACTCGGCATGCCGTCCAACTACGCTCGCGCCGG
CTGGGGTTACGCGACCGTCGCGTTATTATTCATGGCGGTATCGAACATCTACGCCACCGTGCTGCTGTCAAAGGTGCTGATGGTAGCCCCATCTTCTGTG
AAGACTTACGGTGACCTCGGCGAGTGGGTCGCCGGCAAGTGGGGCCGTTTTTTTGTGGTAGTCTCCCACATGGGCGTTTGCCTTCTTGCTCCCTGCGCAT
TCCTCGTACTTGGTGGTACGCTGCTCGACGTGCTCTTTCCCGATTCGTTCAGTCAAACCGTGTGGATCATCTTCATGGCTGCAATGGTCATCCCTGTGGC
GTTGATCCCCACTCTGAAAGAGAGTGCCGGCATGGCTGTGGCGGGTTGCCTGGGCACGATCATCGCTGATATCATCGGTGTTGCGATTCTCCTGTACGAA
GAGCGCGGTCATCCAACGCCCCCAACGCCTGACGTAACCCTACACCAGGTGCTCACCACGTTCGGCAACCTGTCTCTCGCGTACGCCGCTGCTATTGTGA
TCCCCGACCTCCAGCGACAGCATTCACAGCCCGAGCGCATGCCTCGTGTCATTGTCGTCAGCCTGGGTCTTGCCTCGGCCTTCTTTCTCGCCATCGCTAT
TATCGGCTACGTTGCTGGTGGGTGCCAGCTCTCCGGTAATCTGCTCTTTTCGATCGTGAACACGTCCGACCCCTACAGCACCACCACTCTGGGTTTTACG
GCGAACCGGGGAGCAGTGGTCATGTCCTACTTATTCATGCAGCTTCATCTGTCGATCGCCTTCTCGACAATTCTACACCCGGCGTTTTACATGGCGGAGC
GTCTCGTGTTGGGGATGCACAAGGATGACACGCTTCCTACTGACAGCGAGGAGCGTGAGATTGAGATTGAGGAGAAGATGTCGTACCTCGGTGCGGCGAC
CCCTGCATCTGCCGTCCCCGATCTCGAGAACAACACGCTTGGTGCTCAGAACCAGTGCTCGGTGCGTGAGTCGAGGACGAAAACTGAAGATGACCTCTCT
GAGTACAAGGGCAGCGTGAATGTGGTTCGTTACGTCCTGGTGCGTATCGCTTTGATAGCGATTCTAGCTGTGGCCTCTATCCTGCTGAAGGACCATTTCC
TCGACTTGGTGGACTTTACTGGTGCCACTGCCATCACTGTGTGCAGTTTGATCCTGCCGCTTATTTTCTACGCTAAGGTGTTTTGGAGGAAGATTCCGAT
GGGGGAGAAGGCAATTTGCATCACGATCTCCACAATCTGTGGAATCGTCGGTTGCTATGTGATGATCTACGCAGGAAAAAAACTATTCAATCCGGATGAC
GATGGAGCCACGTTCCCGTACTGTTCAACTGAGTACCAGGACGAACCGTACTATA