Description :
From Genome Similarity Track
Location :
Scaffold_1:708139- 710933
Sequence
2794 bases(100 bases per row)
CCTCCAGGACGTTCTCGTCCAAGACAGAGGAGGAGTTCAGCTCCTCCTGAGTGGTCTCAGGTCTCATGAGTACCATCTCAGCAATCTCTCCAGCCTTGAG
GTTGGTCAGGAAAGACTCAGCCGTCATTTCCTCGAGGTGCAGTATCTCTGCAACCTCTGGCAGCGGTTCCAAGTGGACACCAGATGCCTTGACGGGTAAA
CCTGTCTCGCCATCGAAGATGTGATAACACTCTTCCACCGGCCTTGTCGGAGGAGCCCGGGCCCTGGACTCCGAGTCGCTTGAAGCGACGTCGTTCGGAA
CGAAGTTCGGATCCGACTTGAGGCGGCGGCGGCGTCTTTGTCGACGGCGTCTGTGACGGGGAGCTTTGCTGCCCACGTCTAGGGATGTCGTCGCTACGAC
ATCCGAGGCACTCGTGGCCTCGTGTGCTACTGTTGTACCCACACAGGAAGCGTGTTCAACGCCTTCCTCTTCAGTTAAGGTCTGGGCGACCGCGTGTGGC
ACTGTGTTACCCACACAGGAAGCGTGTTCAACGCCTTCCTCTTCAGCTAAGGTCTGGGCGACCGTGTGTGGCACTGTGTTACCCACACAGGAAGCATATC
CGACGTCTTCCTCTTCAGTTATGGTCTGGGCGACCGTGAGTGGAACTCTGTTACCCACTCTGAACACGCTGTTCTCAGTGTTCATGACAGTTGCAGCTGT
CTGCGGAGCTAAGTTACCCGCTTGTGGACCTAAGTTACCCACTTGGCCAGCGCCTCCTCTGGGCGCTGTCACCATCAAAGCATCCTTGGAGTTGTCATAT
ACGTCGACGACGCTCAAGCGTCTGCCGGATGCTTTGGTACCCTGGCAACCCTTGCGGGCGCCCCGGGTCCTGACAGAGGTGGGAACATGACTCACCAATG
CTCTGTCGGACTGCGTAGGGCGGCTGGCACCGATTGCCTTGCCTCGCCAGTCGATCCAGGGCTCGTGCTTCTCAAGCCAGGGCATGCCCAGGATCATATC
ATATGGATCCATATCAAAAACTGTGAGCTGTTCGAGGCTGTCAAAGTCTTCAAACTTGACGGCCAGATCCACTTGGACGTTGGGGACAGTGACGACCTTC
TCGTCGGCCAGTCGCACTGACACCGTCCCGTTGCCCTTGCTTTCTCTCAAAGCTTCGGACAACTTGTTGCTGTTACGAGCAACCGTCTGGCGGCGTGCGA
AATTCTTCGACGCCCCAGAGTCAATCAAGATTTTAAAGGGATGATCGTATCCCCGTACACATCCGTGTACTACGAGCAACCCGCCGCTGCTCTTCGCCGA
TTCGAGAGTGCGAAGACTCTCAGGGGCTAAGTCCCCGTGGTACGCGCCACCCGCGCACCCATCACGAAGACTTAGTTCTTCCCCAGTAGGGCGCCCCGCC
TTACTGGTTCCCTGCGCTCCCCTGTCCCCGAATTCCTGGCTTCTGCCAGCGACCCTTGAGGACGGGCTTGGGGAAGGACCGTCTACGAAGTCTTTCCGCG
GGACAGTCGCGCTTGAAGTGGCCCATCTTCCTACAGCCGAAGCTGCGGATGTCACGCTGTTCGGCGGACCCGAGTTCCATGGGAACTAATTCGTTGGGGC
TTGTTCGACCGGGAGCCGACAAGGAACTCCCAGGCCACGCTGAGGCCGGCGTACGCGCCTGGCGATGGCTGTACTCCTCCTGAAGAGCCACTTGAATCGC
CTCTTCAAGGGTGCTTGACTGCACCCGGAACAGCTGAGTGCGTGCGGGGCCCACTCGAAGGCCGTCCATGAACACAGTCATCTTGATGTGTTCGTTGAGT
GGGTTTCCCACTAGGGACGCCGTGAGCTCCCGTATCTCTTGCACATACTCGTGCAGCTCGCGCCTTCCTTGTTTACACGCGAGGAAGCGCGAACGCTGGC
GGTACTCGTAGTTTGCCGGGAGGAACGCGGCTCGGAGCTGTTCGCACAGCTGAGCCCAGAATGTGAAACATCCAGGGGATGTTGCTTCCCGAGTGTACAC
CCAGCTCTTAGCACGACCGCTAAGGTTGGAGAGTGCAAAAGCAACACGCAGTTGCTCGGTCGAGATCAGAGCCGCGTCCATCGCGAGCTCTACTTCTCGG
ACCCAGAAGTGAAGGTTCTCGCCTTCCTTCCCTTCATACGGCTTAACCTTCAGCCGTATTGGCTTCGGGTGAGGTGGATTTGCTTCCGCAGCCGGAGCCT
GCAGGTTCTCCCGCACATGCGCGATGAGGCCCTGCTCGTACGCGTCGAATGCATTGACGCGCTCGAGCTGCTCAGCCGGTGTTGATACCACCAGGCTCTG
CAGGGCCTCCATCTTGAGGATGCCTGCCATCTTCCAAACCGACTCGAAGTGAGAGTCGTTTAAATGGGAGAAGTCGTTCCTATCCATGGCAACGAACTTC
GGAGAGGTTCAGGTAGTCTATCCGCGGTGGCGTGGATTGACTACTAGTGCTACCAAGTGTGACGGGGTCACACAGCACCTTGCGCTAGAGGAAGTTATCT
TCCGAGAGTATACAAACTCTCAGTGAGCGGCAGTTCACAGGTCCCCTCTTTAATTAAAGAGAGCGAAGTGACCTAAATAAGGTAGATTGTAAACTAAGTA
TATTTATAGGTAGGTTAAGTTTGGGTTTAATACAAACTATTAGCTACTTATAGAAATGCAATCAATGGTTGGCTTTGAACGACCTTGGTACCTTGTACCA
AATATCCCGGAGTATGACGTGTCATACTCCTGAAGTGTGAAGTGTCACACTTCATGTAACCAGGGTACACTTAGGGCTACGTACCCCGTTACAC