Description :
From Genome Similarity Track
Location :
Scaffold_241:7080- 12689
Transcript NameFunction/comments
Hyaar_Emoy2813081hypothetical protein

Sequence
5609 bases(100 bases per row)
ATCGTTCATCGTAGCGAAAACGCGAGAGCTATCATGGGAAACCCCTTTTGGCGAGATGGTCACCAAAGTCAATTTTTAAAATGGTAATTTGAAGATATTC
AACAATTATGCATTTTAAACGACGACTATTTACCCTATCCCTAAAAGAATGACCCAGCCGAACAAAAATGAAGCCAGCCGTTTAGCATTTTTCATTTACT
AAATACGCACCATACACCACACCTATACCACACCACTGATCGGCTTGTATGACATGAATCGCGCCACCAGACATCTGAACGACCATTATAGCACGACAAT
CTGCATTTGTCGTACAAATGGTATGTATTTTGCCAAGCAAACCCTTTTTAGCAGGCAATAGACGACTGAAGCTTTATGCATTCCTTAAGGATATATTGAC
GACCACGGCGCATTCGTTACTACACGTCGGATACATCTAGGTTGCAATTTGTATTTTAGAAATGGCAATAGCCAGGATTCAGTCGGGAAAGATACAAAAA
TGAATGAAAATAAGGTTCAATTTATTCTTAACATAATCGGATACATCCGTCGCAACAAAAATACCTCTTAGAACAAGAAATTGTACAATACATATTTATA
TATTTTTGATTGAACCAAACCTGGATCTGCGTTAGGACCTGGCCATTGCCCGTCAACGAAAGCTTGGATAATAAAAGGAAAAGTAAAAGAAAGCCACATT
TAATCACAAAAATAAAAAGGCAGTCGCTGTGGCCACAGACACTGATACTACGGCCACAGAGATTAATACTTCGGCCACAGAAAATTGACCAGCCAATCAC
AGCTCAGAAAATTCAATTGTAACTACGCACTTCAGCCAATCAAATCTCCTATTTAATTGTACACACGAGCTTCTGCTTCTTATGCGTGTCATATTAATCT
TGTTCTAGCGTAATTACGATTCTGTTTTATGAGTTCCAACTGCTATCTATGTATGGTATAGAGATTACTATACGGATCTGGATTTTAGAACGGTGGTTGC
TGTTGATTAGGATCCTAAACAAGGTGACGTTCCAATGCCGCGAGAGGTTGACTTCGACCCTAAACGTTATCCGAACATGTTGCAAATTAACGTCGGTGTC
CCGTTTAATGACAAGCACTGCACGTTGGTGCCTTCCTCTTCCTTGATAATATCCTTTTACGTATCAAAGTGACAAGGATCTCGTCGTGTTGAAGTGTCGG
TGCTTGTTCCGCTTGGTCTTCCTTTCGTTCGAGCAACCTCCGGTTCTTCAAGGACTTGTGGTGTTTGATAGTATAAATGGCGTTGGTATCTATTGGATTG
TCAAACGGAAAATAACCACCACAAAAAATACCTGCTATAAATTAGTCAGCTCCTCCACGACTGCCTCTCTCTGAAGTAGAGGCAACTTACTAAAATTGTC
TTGTAATGTTTCGAAAAGGACTCGGGAAAGATCGTCTGGCTGATCTGCAACAAATGGTCGTACTGAAGGGAGTTAAAGTAGGTGCCTATGAACGTCAAAT
CATTTAATTCCAGTTTTCTCGCTCTGAGATGATCAAATTCCAAATTGTGCATGCAAGGCTTTCCCTAAATGGTAGTGAAAGTGGAAGTGCATAGCTTGGC
GTTGATTGCCATAGGACGTCGAGCCTTATTCAGCTGTCATTGCGAAACGTTATTAATTGATGGAAACACCTAGGAAGATGAGACAACTATAATCTCACCT
GTTCAAATACTTTCAGAACGGCGTAACACGAGACATTCCGGTTGATATTTTGAAAATTGTCACCACGCGGAATCGACTGCGTGAATGGCAAGATTTACAT
TTACTGCTTCGCCATTTCTGCGGTGAACTAGGTCTGAAAGATTTCGATCGACTGAACAACCCGTTTGCAGCGCCCAACGAGATTTTCCATGCCACTTGCA
ATGAACGCTGTCACGACATTGTGGGCACCTTCTCCACGTGAGGTGACTGTGTGGCCAAAGTGCCGAATAGAATTTGTCCATGTCCGAGCGATCTTATTCT
TGTGGGAATTGATCCACGTCTTGGGAAGATATTCCATAGATTCGATGTCGTGTTCGGTCCATGTCAGTTAAAAAATTACTACTTTTCTGCGAACGCCTCG
ATCGTGTTTGGGTAAACCACCTGTACAATCAAGTATAAATTAGAACATGAATAAATTATTAAGCAATATCGATCTCAAGAAACGAAAGGAAACATTACCG
ATATCGTATCTGTTGTGAACGCTTTCCACTCCTCAACATCCCTCCCAGTAAATGGGACTTGCATTTGGCAACAACGTTCTTCTCAATGTGCTAAACGCAA
GTCTGGATGGTTGCTGAATGAAATACAATCCGCACTTTCATAAGGGCCAGCTCTCTATCGATAAAGAAAACTCTGGGCAGACTGTCGGCATGAAATGATC
GACGTAAAACGTTGATAGAGAGGTGACATTCGAGTCGGCATCCTCGTTCTTCATGAAAATGAAAGCCACCGAGAACGTCGAATATAGCATTGTATTTCGA
ACAAAGTGGAACAAAGGATAAGTCTTCATGCTTGTTTTGAACGTGGAATACAGCAATAAAACTTTGCATTTCTTCCATAAGAGTTCTACGTTGTTTGGAT
AAGCAAAGAACAAATGTGCGATGCGCCCATCGTTGTCTTTCCCTATGTTAATTTTAATCCAATCTCTGTGAAGGTTTGAAACAAAATATCGATGGGAGTC
CGTCCATCGAGTTTAATCGGAGCGTTCTTTTGCTTCAAGCTCCAAATCTTTCTATTTGTAAGTTCCGATTGCTGGCCTCCTTCTTGTACCATGGTTTCAA
CCTGCCTGACTTTTAAGCTATACTCAAAAAGCCAGCAATTTATCCTCTCGAGACTCCGAGACACGAGTGTGAACTGGATGGGCTGTCCTAGGGGTGGACG
GTTCCTAGTTATGCTCATTCCAAGTGATAGTAGAGATCCAGGTGTTGTCTGTAATGGAGGAGGAGAATATTAATGTGAACGCTTCGAATTTCTCGTTCAA
TTTATTCAACCTTGATGCGTAGCTTTACCTTTCGCTTCTCAACTAACACCTTGAAATGGCAGTCAACAAGTGTACCGCCTTTCTCCGTTCAAATCGTTGT
TTCTTCGACAAATCCCTGACGATTTCGATCAACGCCTTTACGATCGCATTTGTAGTGAACAACTTGTTGTCCATCTTGTTGCTTATATGAGGAATTTGGT
GACAATTCCATAGCCATTTGCGACGGCTTTCGTTTTCATATTTTCTTCCAGGATCTCCGTGGAGTGAATTGCTCGTTTTCCTGCTGCTCCATGTCCATGT
CTTCTGTGAGTTCTGAAATGTACAAATATGCGATAAAATTGGGTGGATCCTAACCTTTCGTCTATTTCTTAAAGTGTTTGTTAGGGTGGCGAGTGATAAT
CGACTAATGGTAATCAGTAATATATTAAAAATAATTGAATATATTTTTGAGCTGTGATTGGCTGCGTCAATTGTCTGTGGCCGTAGTATTCGTGTCTGTG
GCCATAGCGGCTCCCAAATAAAAAATGCCCTACGTCCAAGTACACTCTAGTTAATGTGGTACATATAATAATTCATATCGGTAATCATTTCTCAACTTTT
TTGAATGGCCGTTTTTATTCCCGCCCTGCCGGTGGAGCCGCGTAGGGGGTTCTGCCGCGGGCGTGCTACCCTCGCAGCCATCAGTTGCAGGCGCGGACGG
CACGAAATCCGTGTTTGTATCGTCGGCATCGGCTGTAAATGTAGAAGATTGGTGCTGATGGAGTTATTAATGGTATTGTTTTTTCTATCTTTATTGCGAT
TGTTACTTTTTATTCTATTTGTAGTATTGTCATTTTTAATTATAGTTTTTTTTTGTTCAACTGCTACTGTTTTAGTGCTGGTGTCGTTGTTGCTGCTACC
GATGTGGCTGTAGCCGTTGTTGTTATTGTTGTAAGTACTTTACGTCGTTCCTGTTGCTTTGAAACTGCTACTGCTAAAGTTGGTGTTGCAGCTGATGTCG
TTGTTATTGGTACTGCTGTTAGTGTTCTTTGTGTTACTACTGTTCAGTGGTATTGTTGGTACTACAGTGCTGCTGTTGTAGTTTTTTAGTTATGGGATAG
TTATACGTACCCTTCACGTACTAAATAGACACTTGGGCTTTTTCACCATTTAATATACTATCATGAATCCATTCTACCTGTTTGAATCTTATTTTATTAA
ATCGAAAAAGCTTTCTCAGTGCTGATGGCGACATTGTAGTGCTATTGCATGGATTAGTCGGTGCTGTTGAGATTTCCCGCCAAGGACATTAAGCTAGTAT
TGCAGAGCTCAAGAGGTAATGATATCACACAAAAGAAAGTCGACTTGGCAAAACTGTTTACTCACCCCCGCCCCCCCAGCATATATATATCATAGCTTAA
GGAAACGGATACACTTTGCATTGAAACCTACGGTACGGACTTCAACATGAGAAATGTAAGTTTGTCAAACTGTATCCGTCAGAAATTGGCATGTGGCCCT
CTAATGGTGACATCTGGGGCCAGACCACGTGCTGCATTGTTGCGATGTGCTACAGAACTTATAAAGTAAATTGGTAGTAATTAGTGGCTCTTACGAATGT
TAAGGACCTACACACCCGCCATATTCAATCAATTTTTTTCTCTAAGGCACCTAGCTTGCTCATTATTGCACATTGCAAAAATGTATCAAAAAAAGGTAGC
GTTTATACGCCAGCATAGCATAAGTCCACTTTGTTACGGTGCATATTCGCGTGACTGTTATAATGGATTCTTCTGTTTTAGATAGTCAGACGTATCAGTA
TATAGCTGATGAACGGTATTTATAGTAAAATAAACCCTTTTTCGAAGCACAACTTCGGTATATGTGCATCATATTAACTAGAGTGTAATAGGACGTGGGG
CTTTTTTATTTTCTCATTATCTGGGGCATTTTTTAGGGACTGACTAGGTAGACACCCCCTACTTCCTATGCGGACACCCACTGGATAAAAGATATTATAA
TTATCTAATAATGATGGTGGCCCCTACTTCAACGCGGACACACTTTGGATGAGGGATACGATAATAATCCTACAATGCCGGTGCCTCTAATTACAACGCG
AACAACCCCTGGATATAGATATAATAATTATCTTACAATGCCAGTTCCCACTGAAATTATCATTAAATTAGAGTTATAATCACAGTGCAATTCAGAATGT
TAGACCATCCTCCACTCCTCTCTCCACCTTGCCAACCTTACGTTCTATGTATAAAAGTTTCTGTGATCTCGCCTTAATTTGGTATAACCTCCTTCCTAAT
ATCATGTTTCAGTTGTATCCCAGAGACACTCACGGCTAAGACTATGTGTCCATGAATATTGATAGGGAATAGCAAGAGGAGCTAGTGATAAAAGATAAGT
AAGAAAATGAACTGCGCTCTGCACTTTTGCTGGTGATATAGTACTGGCTTGATCTACCACAAAAATTTCTCTGTACGAACTACACAGATGCCAGAGCCAC
CGCCAACTGACACTGTAAATTACCTCATATAATCGTGTCCAAGGATATGCAACGCAGTGGTTGAGAATGAAGTTGTCAAAGTGTATTGTAGGATGCGCAC
AGGAAGATC