Description :
From Genome Similarity Track
Location :
Scaffold_719:708- 2075
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_719-fgenesh-gene-0.0Glucose transporter

Sequence
1367 bases(100 bases per row)
CGCGCTGCTCCATGTCTTGCAACTCGGGTGGTCAGTCTCGCAGCTGAACGTCAAGGAATTTCACGACAAGAATGCATGCAATGCTCGGCCGGTCGTCGAC
GGCACGTGCGTCATGTTTCCAGGCCATACAACCACGCAGTGGACGTGGATCGTCAACGCCTGGGTCTTGGGCGGCATGGCCGGCGCGCTGTCGATTGGCC
ACCTCTCGGATCGTTTTGGTCGCAAGACCATGCNNNNNNNNNNNNNNCCTAGTAATGGCCATTGGGGCGATCGTGCAAGCCAGCGCGTCCAGCGTTACCG
TGTTTGTGATTGGCCGTACCATCTCTGGACTCGCGTCGGGCGTTGCGACCGCCATGCCGAATGGCTACATCAGCGAGATCGCACCGCCGCATATTCGCAC
CAAGCTCGGCGTCGGCTTTCAGCTTGCCATGGCCACGAGTCTCATCCTCGTCTCCACGGCGTTTTTCTTTGCCAACACGGCCAGCGGCTGGCGATACATT
GCCGGTTTCCCCGCTGTCTTGGCGCTAATCTTTGCTGTCGCTGCTCCCAAATGCATGGTCGAGAGTCCGACGTGGCTGCTCGGCAAGGGCCGCCAAGCGG
ACGCTGAGCGAGAGATCGCCAAGCTCTTTGGTCACGAGAACGTTGGGCTCGCCCTCTCGTGGATGCAGCCACAAAGGACTGGCACTCCTACGACCACCAA
GATGCAGCAGGCCGATGCCGACGCGGTCGAGGTCTCGCCCTCATCATCAACGATCGTCGAGAACCCGTGGAAGGCGCTGTTTTCGCCCGCGTACCGCCAG
CAGACAATGCTGGCCATCATGATGACGTTCGCAATGCAGTTCTCTGGCATCAACGCTGTCTTCATGTACTCGTCGTCCATGTTCAGTGAAGCCGGCGTCT
CGGACGGTCGCGTCGGCACCATCATTGTCAATACGGTCAACCTCCTGCCGTCGTTTGGCGCAGGCTGGCTAGCGTCCCGCTACGGCAACCGCTCGCTACT
GCTCATGGGGCAGAGCCTCATGATCGCGTGTGCCGTTGGCCTGACCGTCGCACTGCTGGCCAACGTCCCGGAGCTGTCGATCGCGTTCATCGCGCTCTAC
GTTGCGGTGTTTGCCGTCACGCTCGGCTCGCTGGCGTTTGTTGTCGTGGCCGACGTGTTTCCCGACGAGCTGCGTGCGAGCGGCGGGTCCGTCGCGCTCT
TTGCCAACTGGGTCGGGACGCTCGTGATCGGCGTCGGGTACCCGTACGTCGCGGATGCACTCGGTGATCTCGGTTTCTTGCCGTTCATTGCGGCGATGGC
GTTCTTCACGCTCTTTATGTTCAAGTTCCTGCCCGAGACCTCACGGAAGACGAGCGACGAGATCCAG