Description :
From Genome Similarity Track
Location :
Scaffold_139:708- 2007
Transcript NameFunction/comments
Hyaar_Emoy2810846hypothetical protein

Sequence
1299 bases(100 bases per row)
TTACGCAGAAGATCGCTATCAGTGAGGTCTCTACACATCATATTATTCCTTTAGAAAATAATGCTGAATGGAAAAATACAACATAGTCTGTTTTAATAAC
GAACATAATAAATGCTGCTCCAGATAATTGGAAAATAAAAGAAGCCCCGCGTCCTAATGTACTCATGTTGACGTGGCACACATGGACCGACGTTATAGTT
TGTATAATAACTTTACAATTTATGGTCAACTTTCCTACGCGATATGCTGATAGGTCTGACTTACGAAAAAGGTGAGTTTGAATACGGTCACGCCGATATT
CAACGCGACAGAGTAGACAGACAGACATATGATATGCCTGCATGTGGTGTCATCACGTCGATACATATTTGAAAAGGGCGTGCAAGCCAGGTGCCGTAGA
GTAAAATAAGGCCGAATCTAGCGGTTGTATAGACCCTTAAACATAAAGAAGAGCCTTTAATTATCACTCCTTTACTATATAAAGGTACATTATATAGTAA
AGGAGTGTTGCACATCGTTAGAGCGCAGCACGAGGTACCAGATATGAACATAAGAGATCCGCATGCCAAATTCTGGAGAATAATGTGAACATATATTAAC
GTAAGAGAGCCGCGTGCCAAAGGCGTAATGATACTGTCCAACAACTAATAAAACAACTTGTTAAGGTTCGTAACATACGTTTCAATGCAAAGTGTATGTG
TTTCTTAAAACTATGGCATAGATTTTGACGTATTTTACACTTCGACCAAATCAAATGTCGTGTGTGTTGTCATTACCTCTTGAGCTACCCACGTCCATCC
TGCCGTCCTTGGAGTCTAAAATTATAACAGTACCGTTGACTTCTTGCAATATCACCAAATGCCTCTATAGGCACTGGTAGGGCTGTATATTTGGTTTCAT
ATAGCCTAAAATCGTACATTCATCCTGTACACAGCTTTGAGCTCGCGGTAAAATAAGATGGCACTGTCTTATCTTAATCATAGTAAATGACATGTCAGAG
AAAAATACATTAACGATATCAATCGGAAACGTCCGAAAGAACCTATAAAAACAAATTCAATCTACAACATGACAACCAACTCTGATAAACTATGCTTAAG
CATCACCGTTACTTTTCCTGCTTGCAATACGCCTGTAGTCGAAGAAGCCTGAAAGCTTTCAAATCAATTTTACATGAGACAAACAGATGAAATGGATCCA
TAATAGCCTATCGAAATGATCAAATATGCTTAGGTAACTATGTAAAATGACCAGGAGCGAGTTCCTAACCCACAATTGAAATAACAACACCAGCAGCAC