Description :
From Genome Similarity Track
Location :
Scaffold_3986:708- 1890
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_3986-fgenesh-gene-0.0ATP-dependent RNA helicase

Sequence
1182 bases(100 bases per row)
CGAGACGGAGCAGGCGCTGGCGGAGGTGGCCAACCATACTGCCAACGAGGGAGCGGTCGACGAGCGATACTTCTCCGCCGAGGAGTTCGCGTCCCTGCCA
CTGTCGGCGCCAACGCGCAAGGCATTGGACGAGATGGGTTTTAAGAAGATGACCAAGATCCAGGCCAAGTCGATCCGCCCGCTACTCGCTGGTCAAGATC
TGCTTGGTGCTGCCAAGACCGGTTCCGGTAAGACGCTCTCGTTCCTGATTCCAGCGATCGAGCTGCTTCACAAGGTCAAGTTCACCCCTCGCAAGGGCAC
GGGCTGCGTCGTGATCTCGCCAACGCGCGAGCTTGCACTGCAGATTTACGGCGTTGTGCGCGAGATCTGCAAGTACCATTCGCAGACCCACGGCATCGTC
ATGGGCGGCGCGAACCGCCGCGCTGAGGCTGAGCGCCTCGTGAAGGGTGTGAACATTCTGGTGTCGACCCCGGGTCGCTTGCTCGACCACTTGCAGAACA
CCAAGGCGTTCATCTACCACAACCTGCAGATTCTCGTGATCGACGAGGCGGATCGTATCCTTTCGATCGGTTTTGAAGATGAAATGCGCCAGATCATCAA
GTGCATCCCCAAGGAGCGCCAGACGATGCTCTTCAGTGCCACGCAGACCAAGAAGGTGGAGGACCTGGCGCGTCTGTCGATCAAGGAGAAGCCGGTATAC
GTCGGCGTCGAAGAGGAAGACACGAAGGCCACCGTCGCCACGCTGGAGCAGGGCTACGTGGTCACGCCAAGTGACAAGCGTTTCCTGCTGCTGTTCACGT
TCCTGAAGAAAAACTTGAAGAAGAAGGTCATGGTCTTCTTTTCGTCGTGTGCGGCGGTCAAGTTCTACGGCGAGCTGCTCAACTACATCGACATTCCGGT
GATGGACATCCACGGCAAGCAGAAGCAGAACAAGCGTACGACCACATTCTTCCAGTTCTGTAACGCGAAGACGGGAATCATGCTCTGTACCGATGTGGCT
GCGCGTGGTCTCGACATTCCAGCTGTCGACTGGATCATCCAGTTCGACCCTCCTGATGACCCGAAGGAGTACATTCACCGTGTCGGTCGTACGGCTCGTG
GTGCCAAGGGAAAGGGTAAGGCGCTGCTCATGCTGCTACCAGAGGAGCTGGGCTTCCTCAAGTACCTTAAGGCTGCCAAGGT