Description :
From Genome Similarity Track
Location :
Scaffold_325:70788- 71845
Sequence
1057 bases(100 bases per row)
CTACGGGCCGGATTAAGCGATATAAAGCTCGACTGGTGATCAGAGGCTTTCTACAACGCATGGGCATCGACTACAGTGAAACATACGCACCTGTTATCAG
ATCTGAGACGATCAGATGCGTGATCGTATACGCACTGCAACGCGGATGGGCCATCTTGCAGTTCGACGTCAAGACCGCGTTCTTGTACGGTGACCTCGAC
GAGGAGGTCTACATGGAGCAGCCTCCAGGCTTCGGAGAAGACTCTACGCGCTATGTATGCAAGCTACAGAAGAGTTTGTATGGGCTAAAGCAAGCGCCTC
GCGTTTGGAACAAAACATTGCACAAGTTCCTGACGAAGATCGGACTCGAGCGCCTCGACTCTGACTACGGACTCTACGCCAGGAAAGTGGGAGGAGAAGT
CACCATGTTGCTCACGGTGTACGTCGACGACCTACTGCTCCTCGGCCCTAGTGACCTTTGCGCTAAGGTTGCTAAGCAACTCAGTGAGGAGTATGAACTC
ACATCTCTCGGACCCGTCAAGTATCTACTAGGCGTGGAGATACTGATCGACAGCGAGCGTCGACATGCGGTATTTTGCCAGCGGCAACATATTACGGAGG
TGCTAAAGCGATTTCACATGGAGGGTTGCAACGCGGTTGCAACACCGGAAGCGCTGCGCGCTGAGGTGGTCACAGATGCGAAAGATGACTCCCCGCCCCC
GTACCGAGAGCTCGTTGGTGCACTACAATATCTGGTCTCAGCCTCAAGGCCGGACATTGCGCACGCTGTGCGTAATCTCAGCAAGTACCTGTCCTGCTTC
GACCACACACACTACGCTATGGGAAAGAGGGTGCTACGCTACCTGAGTGGTACTCAAGACCACGGCTTAGTGATGGACATTGTTATTGGGAACGACGTCA
AGCTGACGTGTTACACCGATGCTGACTACGCTAATGACCCTGATGACCGAAAGAGTGTTAGCGGGTTCGTGACGTTCGTCAATGGTAACGTGGTTTCGTA
CGGATCAAGAAAGCAAGAGATTAACGCACAGAGCACAGCGGAAGCAGAGTATATTGC