Description :
From Genome Similarity Track
Location :
Scaffold_98:70781- 72010
Transcript NameFunction/comments
Phyta_totarag3540hypothetical protein PHYSODRAFT_552999

Sequence
1229 bases(100 bases per row)
agcgacgacgtgtcCGAGACCGAGAGCGCCGAGTCTAGTCAGTGTGGCGCCCCCTACCTGCGTCGACAGCAGTCGTGCCCGTCGTCCGGTCCGCGCAAGA
ACCGACTGGACACGCAGCccgagagcgagagcgacgccGAGTCTACCACTCGTCCGGCGCTCCAGGCTGTCTACTCGTTCGCCCGCGCGGggctcagcac
gtcgtccaagctcttcctggtCAAGCCTCGACACGCGCCCAAGACGCCGGCAGGTGCCACCCCCAGGAGGAAGCCGCACTCTCgcagtgtcgacgtcgtc
tccttggcctccaccaAGTCGGCGGGGGCTCGAGTCGCGACGCCCTTCGGCCTCGGCAAGATCATCGCGATccgagacgacgacggcgttgctgccattG
AGTTGCAGGCTTCCGGACTACTGTACCTCAATGCAGCAGAGATGGACAAGGTGCAGGTGGTCCCTGCGCTCGTTGGGGAGCGAGTGCATACGCCGTCGGG
ATCGGGCCGGGTGTTGAAGTTTGATAACTGGGAGCAGCTGTATACGCTGCGGCTAGGAGCAGGAGGCAGTCTCGGGGAGtacgagctccagcttggcccG
TCAGACGTCCGACTggcagacagcagcaagactgGACGTGCATCGGAGCCGCGGCGTCCGCGCGGCATGTCGGAGGGCAGCTGCGTGGACTGGGAGGCGA
GACGTACTCGTCCCAGACTGTCTAGCGCGAGCTCGACCACTGGattgacgctgctgaagaatATTGCAACAACCTCTTACACGTTCGTAGCGAGTAAATA
CCACCAGGGACAGCCCGTGATCACCAAGTTTGGCGCTGGACACATCGTTTCAGTGGACCCGCAGCGCGGCTCAGCTCAGATTCAGCTCGTGTGGGGCGCC
ATTGCTTTCCTTAACGCCGACATGATTGATTTCTATCCCAAGGCCTTGGAGGGGACCGACGTGCAGACCAAGTTCGGATCGGGTATCGTCATCGGCCTGC
GACCTGCTGATGCTATTTACACGGTGCGTCTGCACGACCCTCAACCTGCAGGGAAGTCGGATGTGGTGTTTGTGCACGAGTCTGATCTGCACCGGAGCAG
GAAGATTGCAGTCAAGGCTGCGAATGTCCGGGACAGACTCAAAGCGATGGCGCAGCGACGTTTCGGTGAACGCATCGTGGTGGCACACcagaacgacgac
gaagaacCGAATTCCGCAGGCATTTAAGC