Description :
From Genome Similarity Track
Location :
Scaffold_20:70780- 71937
Sequence
1157 bases(100 bases per row)
TCGCTACGTGTAAGCTAGTAACGGACACACACCTGGCCCGTTACACCTGGAAGCACTTTGTAGTCCTTCCAACGACCAAGACCAAGATGAGCCAAGTCCT
GACGTCCGGACCTTCAGGGGCAACCCTGGTGCATGGTGCCTTCCCCCATCTCACGCGGATTGAGTGGGAAGCTCTCCACCGCCTCGCGGCGGTGTCCGGA
GAGGCTGTTGTCACCTCGCTGCTGAGCTCAGCGATGCCGGAACAACAGCGCCAAGCTTCCCAAGAATTCATGGAACGCGAGCTCGCCGACGCGAATCGGC
GGGTCACAACTCCCTCGCGCTCCTCGAGGATCGACGTCGTCAAACTCGAGACATCGACATACTCCGGTGTGGGTGACGACCGGATTCCGCTGAACCGCTG
GTTCCGCGAGATCGACATCGCTATCGCCTCGCGCATGATTGAAGCGCCGGCGGCCAAGTTCAACTTCCTACTCTCCCGGCTGTCCGGGAAGGCCAAGGAG
TGGGCCTCGTCGTCGACCAGCACGCGTTCCTTGGATGCGCTCCAGATTGACCTCCGGCTCGCGTTCGAGCCGCCCCAAGACGAGTCGCGCGTTCGTGCTG
AGTTCTTCGCCCTCAAACAAGGCAAGATGTCCATGCACGACTACGTCCAGAAGACACGACACCTTGCGTCGTACATTGTCACCCACCCCATTGACATGAC
ATCTCAGGTGCATGTCTTTGCGTTCGGGATGCGCGAAGGCATGAAGCGGTACTGTCTCATGAGAGCCGAACCCTCCTCGCTCGAGGAGGCATTCGCCCTC
GCGCTCCGCGAGGGCTACGTGGTGTCGGCATCGTACGCGCGCCCTATGCCGGACGTCTCTCGGGTATCCGCACCCGTGCCCATGGAAATCGACGCAATTG
AGGCGTCGGGTGATCGACGGGGCTCAGCTTATGGTGGGGAAGGAGGTCGGAGCGCTCGTCCTCTGATTTGCTTCCGCTGCCGGAAGATTGGTAGAGTGCC
GCGCGCCAGCCCCAGTTCTCGCGCACGTCGATGCCGACGCTAGCCCGGCCGTCCAACCAAAAAACGGCCGGAGCCAGTAGGTGCGGGGCGCCCTACTGGA
TGGAACGAAGGTCCGGGTTTTCCGGTGGCAGCCCAGCCTTCTATCCCTCCCGTGCTA