Description :
From Genome Similarity Track
Location :
Scaffold_15:70778- 84032
Transcript NameFunction/comments
Phyta_totarag963protein phosphatase PP2A regulatory subunit B
Phyta_totarag964hypothetical protein PHYSODRAFT_298687
Phyta_totarag965hypothetical protein PHYSODRAFT_495212
Phyta_totarag966hypothetical protein PHYSODRAFT_491292
Phyta_totarag967hypothetical protein PHYSODRAFT_313216

Sequence
13254 bases(100 bases per row)
GCCAATTATTTTTGATGTACTTGTTCGTGATCCTTCCCTTGATATAGTTCCACAATGGtcaaccagctccagaaACAATGACCTAACGTTTTGGATTGGG
AAATCAATTGAGGTCGTGCTCCACTTGCTTCGTGTTCGTTGCATTTGCTGGTTTGAACCATTGTTTGCGGCTGTGCTCTCTTAACAACCGGAGAtttgac
tgctgctgctaatTTTGCTTGTTGCTTCAGCgacgcgtccagcacgatgcTCAAACCGCCTAGGCGGCATATACGAAAAGGCTGTTGCGGATGGATACAG
CCACTTCGTTCAGTGACGGGTGCCAGCTAGTCTGCAAGATCTTCTTCGAGAAATCCAATGCGTCTGGGTCGCCTGGAGCGGGCATCGCGGCAATCTGCTG
CGCAAGGCCTCGCTGCGGCATGGAGTGGCGGCGACTCACCCGCGCAGTACGCGGAGTGATAGAAATGTCGGCGCGCCCATAGCGGTCATAAATATGGAAC
TCGCTGTTGTACGAGCCCGTGATGAAGTTGTTGCCGTCCCCGCTGACCGCGCACTCGAATTTGtcgaagatgcagtcgctcTCGTACAGATCACCCAACC
GCGGACGAAGATGCTCGTGAATCTGCTCATCGCCAGAAGTTAGCAATGTAGTCCATTCATCAGTAAAGCTATAAACAAGTATTAAAGCAAACAAAATGGA
TACACCAGCACGACTTACATTGATCGTTTGAACTGGGCGCGAGTTCATGTTGATGTCCCAGACCTTCAGTGTGAGGAAATCCCGCGCGATAATGTAGCGT
CCATCGGGAGAGAATTTGATATCCGAAATGGACGCGATAATCTCAGAGAAGAAGCTCCGTGCTTCAGggtcttcctgctcttcaaaCACTACATTTGCGA
CCGCATAAAACAGAAAAGTGCGATATGACTCCAATACACCACAAAAAGGATAGAAACAGGGAGCTCTGCGCACCTTGAGAGTATGAGTCGCACAACGCTG
CCTGCCGCATGTCTCCCAGCTTAATGGCACCACGACTGGTGCTATACATCATGGTGCTGCAATGTGTCGGATGAAAATCCGCGGCTGTGATGACCTCGGT
AAGTTCTTCCATGTTTGCTGGCTTGATGTCCACGATATCTACATGAATAAATGCAGAGTGACACCCACCACTGAAAGCCTCAATCACCAAGTAGCAAACA
CTTACTGAAGCTTTGGTTGGAGATGCCAAGGCTCCACAAGTTCACGCGAAGGTCGTCTGCCGACATGAACGTCTCGCCGTCGCTATTGATCGCGATCGAG
TTGATGTGGTACGTATGCGCATTTGCGTAGACCCGCTTGGCGGTGGATGCCGTAACTTGTCCACGAACGTGAGCTTGCGGCAGTCGAATAAGCTCCGGCG
TTATTTGCGCCCGGGGCATATGAGCGAGTCCCTGTCCATTGTATGTCGTGATTTCACGGACGCTACGCTCGTGCACCTTCCAGAGTTTGATGGTCTTGTC
ATTTGTCGACAACAGACACTGCGACCCGTTGGACGATCGGCACCATTTGATCTGgttgatcttctcctcgatctcAAGACTCTTCAGGTAGTCGAACTCG
GCATTGTGGCTCTGGTACTCGGTGTACAGTTGGTACCTCGGGTCAGTAGATCCGCTGTACACGGTTTGGTTCTAACGTTAATTCATCCAACCCCATCACA
AAAATAAAATGTTAGAATTCGTGCCAAGAGAAGGAAATACAAGTACGTTACACAGCCAACCGATGCTGGGTTTCCGTGGCGGCAGTAAATGGAGACTCGT
CCGCCTTTGTTCCCTGTGGCTAAGAAGTCTCCCGACCGGTCGTATTCGATGGCAGAAATCACCTCAGCTGCAGAATCATgtgacgaggaagaagtgcaCT
CAATACCAAATCATCTCCACAGTCGTAGCAGCCACACACAAAACGAACCTTCCACGAAGCTCCGGGCGCTTTCTCCGGCCGAAAACACTTGACCCCATTC
CGCGTCGGCTTCGCGTGTGGGTTCTGCCATGTTGACGTCCAgcctgccgctgctgtgcttgagTCTGGACAACGCGCCTGTTCGGGCCTCGTCTCCTCCG
ATGTCCCCTTGTAGATTGGCTTGCGTCATGCAGAAGGCGGAGGGAAGTAAATTTCTCTCGACTCGTCCGTTTGTTTGGCGCTGCGAGCAGAGACAAAGGG
AAGGTGGGTGGGTGGACGGGTTGGCTCTTTGCCGACCTAAACGCAGGCAACGGACGCGCACTGCTCGGTGTTCCTCGCGTCTGGTGACCTGGTGCGCTAG
CTGCTCGCTCGCTTGCTTGGGAGATCCTTTACCGCCGCGGAGGATCTCGAGGTGTTGGTTGCGAACTCAAAGGGCCGCTGGGCGGGGGTTTCACACTGAC
AGACGGACGGCTGGACGCGACCACTTAGCAATGAACGGCAAAGAAGAGCGGAGAACTCGTTCTGGAGAGTgaagcgacgacgacgggcGGCGTTTGAAGC
TGCAAATCCCAGGCAGCGAATGACACGCACGCACGCGCTTGCAAGGCGGCGGAGATGTTGGTGATCGATCGATGCTTTTCACTCTCGGTGGTGCGTTGCG
AATGAGGTTtcgccaagacgctggctGACACGCATTGCGATCTTCAATAGCGTTTTTGTTCCACGGATTGTTTCGACCACTCACAGCATGAGAAACTATT
TTAAGCCGCATCTTTTCCACTAATCAGAAGCGATATCTAAAATTCGAAGCACCAAAACGAGCAGAAACGGGGCGAAACGATGGCCCATTTGCCAAAACAC
GGTATGTTCCTTCACCAAAACGCGACAAGGACGGTAACGACCGCAACGGCACTTCACGGACACGATCAATAATGGGCGGTGCAAGTCCTTCAGGATGTGC
tgtttgcttgctgctgacgacTCGCGACGAATACCGTACGTGTAATACGGATAAGAACCGAGTcttacagtacatgtacatgtaagcttgTAAGCTTATG
GCTGTCCGCTACGGATCGCGAGTGCAGCAATGAGACCACATCCTCGAGCTCGGTTCGTAATCGCCGtgttcagctgcttcagggCTCCATTCGCGTCGAC
CAGCCAATCTTGGTGGCATCCTGCAACTTGACACGGCATTTCTACATCCTCTCGCGTCcgcaagcagaaggccaccaaggccggcgacgacgacacgcgG
TTCCTGGCATGAAGCGCGGCAATAATGGCAAAGCGACCACTTTGAAGCGCGAATAGGCTCAGCAGTGAGGGtttgatacatgtacgtggcTGGTGATCTT
TGCACTGTCTCTGGTGTTACCCAGGAAACTTGAGTGTCACTGACCTCCAGTCTGCGTTGCACTGCGGCAGTCTGCTGGACAGTCAAATCTAAATGACGCT
TTCCTCAAACGGTCCAGGATGTCTGCCGTGCCTGCCGCTTGATTGCTGCCGAAGCAGGTGTCGATCATGCTCGCCTTTCGTCGGATATGTTGCCTCGATG
GTCGTAAGACTGGCCGCGAGCATCGAGGTGTCCATCGCAATGGCGAAGCGAGGCGGTTCGCTTGGTTTTGGACGCTAACTTGGAGCTTTACCGGTATCTT
CATTTTGTGTCCttctcacttcaacgtcattttttttactaCTGGACATGTACAATAGTGGTACCTCAGGTAGTCTACCTGTAACGTTAACGCAATAGTT
ACACTAAATATCAATATTCAGGTTTCAAAAATATCAGGCTTCACTCGGACTTTTGCCCGCACAAGTGTAACCAGGAATGATGCGAGCGGGTCCGTCGCGC
ACGCGCGCCGCCAAGGCGCCCGCGGCCTCCGGCGCGGATCGGAAGCGGCGTAGGACGGCGTCGGagtcttcttcctcctcggacgagcaggagctggtga
TCGACGCCCGCCGTGGCCGAGGCAAGCGCCAGAAAGCCAGCGCCATCCTGTCCCAGTTCACGAGCctcgacgcgctgctgaacgacgacaaggcGGAGAA
ACGCAAGCGCCAGAACCGCGagcggaagctgcagaagctgcgcgaggagAGCGAGGCCGCGGAGAAAGATGCGTCGGCTGGAGGCTCGTCGCCGATGGGG
AAACTCATGAGTAACATGGCCAGCAACATGTCGACGCTCTCGGGTGACAGCTACCTATTCTCCGCCTCGGAGGTGACGGTGGCGGAGGAGAAGTTCGGCT
ATGTATTCACGCCTATCACCGAGGTGCGTGCAGGGGCTGTTGTAGAGGCTGGTAGGAGGAGAGACTGACTGTTGCTTGTatgctgcagccgctgcccTAC
CGCACGTACAAGGCGACGGAGACCGAGCTCCAGAGCGACCTGACACTCGTGTATGAGACCATGCAGTCCAGTGACGATGGGGAACTGAGCGGAATGCTGT
GGTCCAAAGCCATCCTGATTCGCTGCATGCTCAAGCGCCAAAGTGAATCAACCACCAGGGGCTCTGCGATGACACCAATCGTCCTGCCTTCGAAGATCGG
GTCGTGGTTATTTATGACGAGTAGGTGGTTGCTCCCTTGCTGTAGGATGGGGAGGTTGATACCGAGGCCTGACGCGTGATGCATTGGTTGTTGGCGGGTT
GTTTTCTGTAGTGTCAACTCACAGCGATAGTCATGTGGTTGGAGGCTGTTTTAGCAATCTCTTTCTGATTCAgagctcggcgaagaagacgtctATCCCA
AAGTTAAGCTCGGGGCTGCCTGTGGCGTGCTTCTCCCACCCAATCGAGGATTTTCGCTCAGCGCTTGGCACCCAGGTCCCTTCAATCGAAATGGAGTGGA
AGCCGTCCATCTACGACGTCCTCAACGCTTTCCGCGCTTACGGTTTCCAGGACAGTAAGCGGTCTATGAGTGTGAAGAGCAAGATCCCAGTGACGCCGCC
GTCCACAAAGAAATCATGCGTGCTGCCGTTTCCGACTCTTAATATGCACTACGTACTGATGTACTTGGTGCTTTGTCTGCGTACGAGGACGCTGACTTTA
GAAGGCTACGACGCATTCAGCTTTACCATGTTCTTCCTGCGAATGCAATTCGAGAACGACATACATGCTAGTATCGTGGACCTGGCTACAATCTGCATCG
AAGAGCTCCTGGACGTGTTTCCTCGTGCGGAGTGGCGGAGGGAGTGGGCACCGCAGCTTGTTCTTCGGATTGCTGGGGCAAATGAAGGCTTGTTTGACTC
GGCCGCGGGTTGGCTTGCAGTCGCACGTCGACTTCCGCGCACGATGCGTGGCACGCAACTTACCACCGGACTGGCGATCTATGTCTTGCAACATCGAATC
GACAAGAAACCACAGGAGGGGGTGCGTTAAGCTGTCAGATCGACTCTACATTGTGTTCGATCGTACTATTTTCTGCTTTAATCTGATGTGCCTTTGACGT
GTAGGCAACTTCTGAGAGGCCAATGAAGTTTCCGATCCAGAGTGGACTTGTCGTGGATATTGTCGCTGGTATTGTGGAGGACTTGACACACAAGTACGCG
GAGACACGCAAGACAGGCAAGGCATCGAAGACTACGCCGCCGTTTGATCTACTCTGTAAGAAGGTGGCATTGATGGATCTGGCACTGCAGGCGTTCCTCA
ACATCCTTACTCCAAAGGAGATGAAAATTATGCTGAACAAACTGGACCAACTGGCTGACACACACAAGTCTACCATGTCGGCAAAGTGGCACGAGCTCAA
GACACTTGTAAGTCTCATGCACCGCAAATACTCGCTTGACAATTTGCGCATCGGCCGGAGTTCAACTTCATCTGCGAAAACCGTTCTGTTCtgtgacgat
gacgacgagtaACAACACCTAGGGGGATAGTGAATAGAGATTAACTGGACAACGTGCGTTAATCTACTGTAGTTGAGTTACACAAcggtagaaagcagca
tgCCTTCCAAGGCACCTTGGTCATGGCCACAATTTTAAAGTTAGTAGGATCTCTGCTGGATTCACCTACCACTACATTGccactactgctgctcctggag
TAGTGCTGCGTACTGCTTCTGCAATTTGACCTCAatcagctgctgcgagttcACGTCGTTCGCCAGCCGTGCCATGCGGCTCTGTAGCGCCTGGGTCTCG
AGACTCAACAAATTCTTGAAGCACGCCTGCTCAATCGCAGCGTTCTGAAGCTCTGCCATGTGGTCGTGCAATGACTCCAAGCCCTGCTGCGAGCGGCGGT
AAAATCCACCATTAACAACCCGCGCACGTTCGTCGAGCTTCTGTGCGCGCTTGGTAAGGAACTGCTCCGTTCCCTTTAGCTCCGCAAAGCGAGCTTGTAC
GGCACGCAACTTGTCCTCAGCTGATGAAGCAAACTGGAATGATACGCTATCACTTTTCCCGTCCCCCTCGGCCTTGCTGAAATAGCGTTCTTGCACTTCA
TCCCACTTCGCACCGATAATTGAGGCATCTTGGAACTTCCAGACGTCGTTCACACCACAAAGACTGGCCTCAATCTGTACCATTTGCCGCGCGCGCTCCA
TATCACTGTCTGAGAATTGCTGTAGGTGCGGCACTGCAACTGCGCTCGACGATTTTTTGCGTTTCTTGCTTTTCTTGGATTTGCCATCGTCCACCGGGTA
TTTGGCAAGATCATGTTCTAGCATGCGGTACATTTCGGTCGCAACCTCGTTCACCTCACTGTGAATCAACATCTTTTTCACCTTCgaaggacgaggaagg
cCCTTCTGCACAGCGGTGGAGCGCCGCTTGAGTTCACGCTCTCGATCCAGCtcacgctgttgctgctcgcgagcttcttgctctccagCATCCTCCTCCC
GAAACGCAGTGGAGCGATCATCACCAGATTCCTCTTTCTCTGGAACGTTGATCTCGTATTCATTCTGCGGCGCGGGCAAACTATCGAAACCTTGACGAAG
GCTGGTGGCTAACCGCTTCGCCCGAGCCTTTTCTGCCCTGGCATTCTCGGCCTCTGTACCATAAAGCTGCTCTGGGTTGATGCCCAGCTCGTCACGCAGA
GGCGTACGCGTGGCAGACATCGGCGTCTTGTCACTCACCGCACTAGCCACAGCCGATGAGGGTGTTCGTGATGGGGTAGCCCCCGCATAACCCGTTCCCT
CGTAGAGATCGACATTCTCGCCACCTAGCAGAGGGGTAGCACTGTTCCGCATAGCAAGCAGGTTCGCCGTTTCCTGCATAATGTTGTCGTGCACATCGCG
ATTAGATGGCGTAGTTGTCGCACCTCCTCCAGTGGCGGAGCGCAAGGGGGTAGCACTGTAGTCACTCATGAGGGTACGCGTCTCGGAGGCCGACCCATTC
TCAAgagcgagcgctgctgcatgggTGGCATGCATCCCCAGCTTGGCCAGATCGCTCAATTCGTCGTTGGAAACCACAGGAGcaggcagctccagcggGG
TGCGTTTAATCGCATTGATAGggtcgttcttctcgttcaccGCAGCGATGACCTGGGGCAGGTTGGACTTCATGAGCGATTTCTGTCTCTTGGCATCCTG
TTTGCGCTCCTTTTTCTCTTGAGCATCACGGCGCACACcctccagcttgtccagttgcagcgctgcacgCTTCGGGTCAATTCGTTTGCTGGAAATGCGT
TTCTCCTCCGTAATATCATAAAAGCCCGCCGGAGCTTTCTTCTCGAACGGGATCTCACTCGCATAGTCGATATATTTGCGTTTTTTCATGTGCACTTTCG
GGTTGGACGACATGATTCCGGCCGCCTTTAGCTCCCGTTTTTTCTGCAATGATGCGAGTCGCCGAGCCTCCTCCAACTGCTTCTCACGggccttgcgctt
ggccttcttgcccttggtATTGGCCAGACGAGCTCTGGCCTCGGAcagcatctccttctcgtcttcgtccatgTCCACCGGGTCGGGTCGCGCCGGCTTG
TTCTCCGGGTTCGGGTCGATCTCTCCAGGTCGCAGCCGTCTCGGGTCGTCGCTCACCTCGAcgccctccttctgctgcgccgcgtccagcagccgcTCGT
AGTGCTCCATGCACTGCGCGGCCGTGCGGCCCACGATGGGGGCGATGGTGCGCCACTGCGAGGGCATGAGCTTGgccagatgcagcagcttctcctcctc
ctcgcgaCTCCACTCGGTCTTCTTGATGCTCGGGTCCAGCCACTCGTACCAGCGCGCCTTGCATTGCTTGGCCGACTtgcgcgacagcagcgacgccacg
cGCGCCCATTGGTTCATGCCGTACTTCATCACGGCCGCCTTGAGGATCTCGTCCTCCGTGTTCTTCCACACGCCGCCCTTGATCATGATCCGCATGGCtg
ctggggggggggcggcCGCCTACAGCGCCGCAATACACACACAAAAAGAGAGATGGCGCCGAGCAAGTAACTGCGACTATGAACGTTGTCCCCCAATTAA
AACCCGTGCCACATCAATGAAACATACATTATGTAAGGTTGGTGTGGAGGTATATTtgcgttgaagttggcgtgAGTCGATTTCATTCAATGGAGCAGCG
CGGGCGGACTCTGCAGGCGCAGCTGCAGTTTATGGAGCGCAATGGCCgcgcgctggaggagctggtggccaagatgatgaaggcgcgggaggagcaggag
acgtTCCTGGGTGCATTCGCCAAGAGTCTGGAGGATATCGCAGCGCAGGAGGAGTTCGCGCCCTTGGCGCAGTGTCTCGGGAACCTGGGCGAGTGTGGGC
AAAAACTGGCGAGCGAGAGCCACGACGTAATGATGCTGAGGCCGGAGACTGAAATCCTGCAGGTGGTGACCCAAATACAGGACTGGGCGATCGTCCCGAT
GAAGGTGCGTGGGCAGAAGGAGCGAAGAACAGGAGAGGGGCCAGATCTGAGTGTGTGGACTGCTATTGATTGGGGAGCAgaggctgctggaagatcggGA
GAAGGCCATTAAGAtcgaggccaagctgcagaaaGAGTACGACGAGCTGAGAGTACGTGAAAATGTGGCTGGCTATGAGGAGATTAAAGTGTGCTGATGG
GTGGCACATGTACGTTGGATCATTGCAGCGAGGAAGCtccgtgaaggagaaggagaagaagctgcggaTGCTGTCGGATCAGAAACGTCGCGTGGAGAAT
GTCAACGCGTTGCTGGATACACACATGGAGAACTTCGACCGCTACCGAAttcagaagatgaaggtgcgTTGGCACTGATGGTCTGGGATCCGCACAGATG
TTGGGTTAAAAAGTCTGCTAATGAGTTAATGTAGAAAATTGTCAGCGAGTTGGCTCGCTCGCAGGCGTTCTATCATGCAAAAGGACTGGAACTCTTTGCC
GTCCCATGCCAAGCTATCACAAAGCTCCACCCCACAGATACAGTGAAAGGAGCAGCGCAAGTGATCCCTGCCGACGCTCGCTAAGGCACCACAACATAGT
AGCAAAAATGATAAGCTGTTGTTGCCGAGTTCATCCACTTGAAAAAGTTAGTCTTCGCAACCTTCACTAATCACGCCGAGCACGACATTTTTTTTGCAGT
GTTCCCAAGCTATAACGCAGCCGAGGAGCGCCCTCTTTCTCGCTCCTTCCTGCGTTTGCTATTACCAAGCTTAGCCATGCTCTCCTGCAGCTTTCGCCAG
AATGATCCCTTCTCGCGTGGTGTGCGTTGTGGACTATCAGTGCCGATGCCAAATTGCTGGCGCCGTGAAATTCCTGGTGAGGCCGTCCAGCTCTGTGGTG
AGTAGCAATAGTTTTCCAATAATTTGTCGCTGTAATAGCAACGTTTCTGCGTTGCACAAGTTCAATCAAGTTAGTCAAGGCTACATCAACAATGCAGAGC
AGCACATGCACTAAATGCCGCCCACCTCTTCGAATTTCTCGTAAACCAAGTGCACAGGCACATCCAGGTAATTAGCCAGGCCAAGCTGTAAGCTGTCGGA
GAACAAAAGCAAAAGCGAAAACAGTTCGTGAGTTAGTCTGCAACAACCCCGTCTTGCATTATACAACTGCTGATACCTCATTTGAACTGGCTGAAGAGAT
ATTTGTCGTCGAGAAAACATCGGAGTCGCTTGAGACACGAATGATACCCCATAGTCCGACTGGGTGCATTGCAAAAGACCACACGTGCTCCTTCAGAACA
TCGCTCATAAACTTGGGGGCACACGGGCACTTTGGACTGAGCTTACCTGCGGCAGATGTGAGAACTTCACCGAGTGCTCATACATGTGTCGATAGACTGC
GTCACCCAGAGATTCCAGCTCACTACCACGTTCTTCACAGAGATGCACTCTATCGATGAATGATGTCCACTATCGTGCACATATGAAGCACAAAAATGTA
TTGTCAGAATGGTCACAACAGCTCCATGCAAGCTTAATTAATGGGAAACTTACCTCCGCGAGAGTTTCTTCATCTGTATATTTGTGAATGAaacgatgct
gaagcagtgTGTCTGCCGATGGTCGCTCGTCTGGGTCAATTGTAAGGCACTACAAACGCACAAATAGTCAGCCTACACACGTTTTCGCGGAACGTATAGG
ACCACAACATGTAGCGAACCTGATCGACGAACGAGCGGCATTCTTTGGAATACAACTCGACAGGTAATTTGAGGCATTGCTCATTTGCAACCTGTAAGAA
AAATAGTCACCGTGTCAGGCAGACAAAAGAAGCAATACAATGAAAGCATAAGGGAAAACTCACGGAATCAACCAAGCCGAAGAACCCGTCCTGCGTTGGA
AGTGGGTAGCGACCCAAAGCAACAGATATCATGGCAAGTCCAAAGGACCAGACATCAGCTACAACGAAAGTAAAATGGATCAGTTAGCACGTTTTGCTGA
AAGGGAACGCGTACACGAACTGACTCACCAGGATAGGAATAATCGCCACCACCTATCCGTTCAGGGGCCATGTACAGAAGGGTACCCACAAAGGTCTTCG
TCGTGGTGGAGTTATCATTCAGAGTGCGTGCCAAACCAAAATCCGAAATCTTGACCTCGCCTTGTCGATTCGTGAGCAAGTTGTGCGGCTTGATATCGCG
ATGCACCATTCGCTTGTTGTGGATATGGGATAAACCGTGCAATACACCAGTTGCTAACCGCGCTAGAACTCTTTCATTTTGGCAGCCACCGCGCAAAACA
ATATCCTGCAGTGATCCCGTACTCATGTACTCCATGACCATGCAAATGGAGTTCTTAGGACGATCAACAAATGCATCATAGAAGGAGACGATGTAAGGAC
TGGGCCTGCACATAACGAGCAATAGCTTTGTTCAGTCAAATGATGGTACCTCTCCAGAGTAAATAACATAATTGCTGTATCATTGCGTACTTCGCTTTGG
GTTTGCTGCCGCTTTTCCCGGTAGAAGGATGTTGAGGCATGGGATTATCATTGTCTGCCATGGGTACAAGGTTTGAATAAAGCGCATGGAGCTCACGAAC
CATTTGCCGGCGCTGACCTCGCCCGTAAACGGGTACATCCTTCATCACGTAAAGAGACAACACCCAAAGTGAGCAAGGAAACACAGATAGCCTAGACCCT
AAAACACTGACCTTGACAGCGACTACTTTCAGTGTTGGGATGTGAATAGCCTTATATACCACACCAGAAGCCCCCCGACCGACTTCTTTTACGCGCTCAA
GGTTTTCTTGTAGGTGCAGACATGCAGCATCAGGCGACGAGATGCCCGCCTCTGATACAGCTACATTCCTGGTGGTGAACATGCCGTGATTAGGAGAATA
AGCACTTCCCGCACTATGCCTCTCGCCATCTACACAATTCAAAACAGAAATCATAACGACACCATACAGAAAGTTAGCATCTTCTATCTGAAATCCATAA
AAATGTCTATAAACCGCACCGTTTGGAGATTGAAGGTCTGAATCTGATCCTGAACTAAAATTCAATTTCATCATCGCCTGTTGTGCGGCACTCGGGCCAT
TTGCAGGGGTATTTGATCCcgatgcagctgcagctgcaatcGCCGCGGCCTCCATTGCATCTCGCTTCGCAATGAGTCGAGTTGCAGCTCGCTGGGCCCg
ctcttcagcttgctgAGGCGTAGGCATGTCTTCCAGTTTGAGTCGTAACTGAGGACGCTTGCCAGAACGACTACCTGGAGTTCTTTTCGCTGACTCGACA
GCTTTCCATAGCGGAGCACCACTTCGCGGGGTAGATACTGGAGGCGGCGTTCCTGCCGAACCCGACCACTCTGTCGTTTTCGGCGGTGATAGCGGCCACG
GCTGTTTCTCTTCAAGTGATAGCTGGTTCGTCAGTGAGTTGATTTCATTGTCCAGCTCCTTTGCTGTGCTATCCACGTTTTCTACTGCCCGGTGAACTCT
ATTGCCGTtagctgctgtcggtgctggagcttgtgcaTCAACACGTGCACGAGCAGATGGGGACGTCACTGGAGTACTCGACTTCCCTGTCTTTGTAGCT
TGTGACAGCAGCCCTCCCTGGAGCGGTTGTTTCGACAACGTTGCAGCTGTCTCTGACTCCGGAGAGACCGGAAACTCCATGTCCATCCACGGACACTCCC
ACGACTTCACCTCTGCAATGCGCAGCTCACGCGGACATATATCCGGAAAGATACGAGCGatcacttcgtcgtccgccTGCCACGCAACAAACACGGCGTC
AGTTCTGATCCCTACAAACCCTTGCTCctctcttcctgctgctgtacctGTTCCGTGAGATTGGGCACCGATTCTGGCCTCACCAGCGGATTCTTTTGCA
CCAGGAATGTCGCATGGTGCAGCGCTCGGCCTGCCCGGAGCACGATGGGGGCGGAGCCTTCCGCCGTGTTGGCAAAGGACGAGCTGTTGgactgcagcgt
cgtgttgGCCGTGGCCCGCTCTCTCCCTTCGCGGTTGTTCCACGTGCGCTGCTCGTAGTTGGCGCTCTCCACGCGGCCGCGCTTGCGGAATCTCTCCATG
AGCGTCTTGCGCGAGACCTCCTCGATGGAGCCGTCCAGCAGGTCGCggcggtggctgctggaggcggcggaggaTCCGCTGGACGCAGCGGATGCAGGTG
GTGACGTCTCCCGTGCTGCGGCGGGCTTGGATACGTGCcggttcttcttctttctgtGCTGCTCCGGCATCGCTCGTCGTCTGCCtcctgctgctactgc
tgctactgctgatGCTGTACTAAAAGATGTGTATCCCTCTCCCTTTGGAATCCAAAAACGACTTTAGGAGGGAGTCGCGATTTAGAGGCATACAGATAGC
GAGCACCTTTCAATGGCTAGTAAAATGTAATTTCGAATGGGTAgccgcttcaac