Description :
From Genome Similarity Track
Location :
Scaffold_20:70767- 76414
Sequence
5647 bases(100 bases per row)
CTAAGCTTCCTCATCGCTACGTGTAAGCTAGTAACGGACACACACCTGGCCCGTTACACCTGGAAGCACTTTGTAGTCCTTCCAACGACCAAGACCAAGA
TGAGCCAAGTCCTGACGTCCGGACCTTCAGGGGCAACCCTGGTGCATGGTGCCTTCCCCCATCTCACGCGGATTGAGTGGGAAGCTCTCCACCGCCTCGC
GGCGGTGTCCGGAGAGGCTGTTGTCACCTCGCTGCTGAGCTCAGCGATGCCGGAACAACAGCGCCAAGCTTCCCAAGAATTCATGGAACGCGAGCTCGCC
GACGCGAATCGGCGGGTCACAACTCCCTCGCGCTCCTCGAGGATCGACGTCGTCAAACTCGAGACATCGACATACTCCGGTGTGGGTGACGACCGGATTC
CGCTGAACCGCTGGTTCCGCGAGATCGACATCGCTATCGCCTCGCGCATGATTGAAGCGCCGGCGGCCAAGTTCAACTTCCTACTCTCCCGGCTGTCCGG
GAAGGCCAAGGAGTGGGCCTCGTCGTCGACCAGCACGCGTTCCTTGGATGCGCTCCAGATTGACCTCCGGCTCGCGTTCGAGCCGCCCCAAGACGAGTCG
CGCGTTCGTGCTGAGTTCTTCGCCCTCAAACAAGGCAAGATGTCCATGCACGACTACGTCCAGAAGACACGACACCTTGCGTCGTACATTGTCACCCACC
CCATTGACATGACATCTCAGGTGCATGTCTTTGCGTTCGGGATGCGCGAAGGCATGAAGCGGTACTGTCTCATGAGAGCCGAACCCTCCTCGCTCGAGGA
GGCATTCGCCCTCGCGCTCCGCGAGGGCTACGTGGTGTCGGCATCGTACGCGCGCCCTATGCCGGACGTCTCTCGGGTATCCGCACCCGTGCCCATGGAA
ATCGACGCAATTGAGGCGTCGGGTGATCGACGGGGCTCAGCTTATGGTGGGGAAGGAGGTCGGAGCGCTCGTCCTCTGATTTGCTTCCGCTGCCGGAAGA
TTGGTAGAGTGCCGCGCGCCAGCCCCAGTTCTCGCGCACGTCGATGCCGACGCTAGCCCGGCCGTCCAACCAAAAAACGGCCGGAGCCAGTAGGTGCGGG
GCGCCCTACTGGATGGAACGAAGGTCCGGGTTTTCCGGTGGCAGCCCAGCCTTCTATCCCTCCCGTGCTATATGCACGTTTTAATGCTACCACTACGAGT
AGCGACTCGAGGCTGATCATCGTCAGCCTCCATGTCGCCGGCGCCCGACGTCCACTGCGCGCGCTCCTCGACTCAGGAGCGACAAACAACTTCTTGCGCG
CGTCGTGTCTGGCGGTGCTTCCTGCGAGCGTTCGCGTCCGGAAGGGTCCGGGCGAGGTGGAAGTCAAGCTTGTGGATGGCAAGGCCCACCGCGTCGCCCG
ACGCGAGGTGTCCCTGCCGTACACGTTCGACGGCTTTCGCAGCAACGACGACTTCCTGGTGATCGAGATACATTACGCGTTCGACTGCATTCTGGGGATC
CCGTGGCTTGCACGGTATCAGCCAGAGATTGACTGGCTGGCTCGGTCAGTCAAGCGTCGAAGTGGCTTCGACGTACGTGAAGTGTTGACGCATCTCTTGT
TGGCTCCAAGAGACTGGCCTCACGTTACCGTCGTGGACAAGACAGCCACGACGCAAGTTGTGCACAGAGCGAGCGATGACTCTCTCTGTCTGGCATGTGC
CGTGCTGTTGGATGATGATTATGTCCGGGTGATATCGCGTGGGCGCGATGACGGACGCGTGGTCGAGCGACGTGCGCTCCCACACAGTGAGAACAAGTCG
GCGGTCGAGCATGGGTTCCCGTCGAGCTACATATTGGCGGTCGAGCATGAGTTCCCGTCGAGCAACGAGTCGACGGTCGAGCATGAGTTCCCGTCGAGTA
ACGAGTCGACGGTCGAGCATGGGTTCCCGTCGAGCAAGATGTCGACGGTCAAGCGTGGGTTCCCGTCGAGCACGATGTCAACGGTCGAGCGTGGGTTCCC
GTCGCACAATGGGACGGCGGTCGAGCCTGGATTCCCGCCACAAGTTGAGCAGGCGGTCGAGCATGAGTCGCTCCCGCACAATGATGTTGCGGCTGAGAGC
GTGGTGCAGCCGCGTACCGCCGGTGTGATCGAGCGTGGCCTCTCACACCTAGAAGAGGGTGAATCATCGTCGAGCGAGAGCGATGCGTCTTCTTCGAGCG
CCCGCTCGAAGCGAAAGAAGAAATCCAAGCGACGCCGCCTGAAGCCCCGTCGAGAACCGTCAGCGACTGAGAACCCACCGAAGGAATCGGTGTGCGCTCT
TGACTACGTGGAGGGCGCTCCACGACGATCGCGCGTCATCGAAGTCGCGAGTCCGCCTCGCGATGCCAACACAATCACGCGTCTCCCAGGACTCTCCAGG
AAGAACTTCCTGCGAGACCTGAAGGCAGGCGAGATCGAGCAAGTGTGTCTGATCACCGAGGCGGTCCCGGTGGATACGCTGCACGCGGTCAAGGTCGAGG
ATGCGCCGTCGAGGCCCAAGCACCCCGAGCCCAAGTCAGCGCGCGAGGAGCGCTTCGCGGCGCAGTCCTGGGAAGCTCTGCGTGATTCCGGTAACCCCGT
GTACGAAACTGCCCGCGAGTACGCGGACATCTTCCCCGACAAGATCCCCGCTGAGCTCCCGGCGGACCGAGGCGTGCGCCACGAGATCGACCTCGCGCCT
GGGACGAAGTACTGCGTGACGCGGCAGTGGCCACTTCCACGTGACCAGGTGAAGGCCATCGACGACTTCTTCGAGAGCCGCCGCCGGGCAGGTCACGTGC
GCGAAAGCATCTCGCCACACTCCAGCCCGACCTTTTCTGTCAAGAAGGCAACGGGCGGGTGGCGCATGGTTCACGCGTTCAACAAGTTGAACGATGTCAC
CATACCCGCGCAGACGCCAATCCCGCGCAAGGACATGGTGCTGGACTCTATGGCAGGAAGTGTGATCTATAGCGCCATCGATCGGACCGATGGGTTCTAC
CAGATACTCATGCGAGAGTGTGACATACCTCTCACAGCGGTAAGCACTCCGAGCAGCATGCTCTGGGAGTGGCTGGTGATGCCCCAAGGTCTGAAGAACG
CGCCGGCCACGTTTAACCGCATGGTCTCCCATGTGCTGCGTCCGCTCCGTGACTTCGCACCGAGCTATTTCGATGATATCTTCGTGCACAGTCGCGCCGT
AGGTGACCTCAGCGCTGTCGAAGTCCACCTGAAGCACCTGCGGCAAGTCTTCCAGGTGATGAGGCAGAACAAGCTCTACGCCAACTTGAAGAAGTTCGTG
TTCTGCGCACCGGAGATCCCGGTGTTGGGCTGCGACGTGAGCAAGGATGGAGTCCGCGCCGACCCTGAGAAGGTTGAGTCAATCTGCTCTTGGCCGACCC
CCACGAGTCCCACGGAGCTTCGTCAGTGGCTAGGCATGGCCAACTACTTGCACAAGTACACCAAGGACTACGCGAAGTTTATCCAGCCACTGTCGTCGCT
GCTGAAGAAGGACACCACGTGGTCGTGGCGAGAAGAGCACCAAGCCGCATTTGGCTCGGTGAAGAGGAGTCTGTCATCCGCCCCTGTCTTGATGCTCGCA
GACGATTCGAAGCCATTCCACGTCGTCTGCGACGCAAGCGACTTTGCCATCGGGTGTGCCCTGATGCAGTTCGACGAGGAGGGTCGTGAGCGGGTGATCA
GCTACCAGTCCCGCCAGCTCAAGCCGGCGGACCAGTGCACGACAGGGAGCTCCTCGCCATGCGCTACACATTGGTCAAGTTTAGGGTCTACCGGCTCGGA
GAGCAGACGTTTGCGGTCTACACCGACCACGCATCGCTGCGAACTGCGATGAAATCCCCGCATCTGTCCCAGCGCATGGCCCGCTGGCTGTCTTTCTTCT
CCGAGTACAACTTCGTGGTGCACTACAAGCCTGGCAAGAACAATATCCTCGCCGACGCGCTGTCTCGGCGTCCAGACTACGACCCACGTGAAGGCCTCGA
GCGCCAGGCAGCTGACGAAGATGATGAAGACGCGTGTGCGGCGTGTGTGACGTCGGGGTTGAACCTGACGAGCGGCGCCCCCAAGATGCCGCTTCGGGAC
AAGATCGCCGCAGCGTACGAGCATGACGCGCAGTACGCCAGCATCCTGGCCCACCTCCGCTCTCCATGCGAGGCGACATTGAAGGCTCTGTCGCGCTCGA
CCCGCAGCCACGTCGAGCGATATCGGCTTGATGGCTCCCTGCTGACGTACACCATCGACCGATTCGATGCCCTGAGAGTGGTAGGGCCGAATGACGAACA
CCTTCGCGCCCGTATCATCCATGAGTACCACGACGCTCCGATCGGGGGTCACTTGGGACGCGAAAAGACCTTCGCGGCGGTGGCGCGAGACTTCTTCTGG
CCCCACTTGTACAAGTGGGTGCGCACTTGCGAGATCTGCCAGCGAGTAAAGCCCCCGCCGTCATCGCAGGCTCCGCTGCGTCCACTTCCGGCCCCCACGG
AAGCCTGGCGCTCCGACTCGATGGACTTCGTCTTTGGTCTTCCACCCGACTCGAACGGGCGCACGGGAGTCCTCGTTTTCGTCGACAGGTTCAGCAAGAT
GGTGCATCTCGTTCCCGTGGCTGCCACGGTTACTACGGAAGAGTCCGCAGCCCACTTCGTCGACGCCGCCTTCCGCCTTCATGGTCTGCCCGACTCCATC
GTCTCGGATCGGGATCCGAGGTTCACGTCCGCATTTTGGACGGAGCAGTTCAAGTTGCTTGGAACGAAGCTGGTGATGTCCACCGCGGCTCACCCGGAGA
CGGATGGACAAACCGAACGCGTCAACCGCGTCGTCGAAGACGTGCTCCGCAGCTACGCTACGTCGTTCCCGAGCTGGAGCGCCTTCCTGCCCCTGACCGA
GTTCGCTCTGAACAACGCCGAGCACTCGTCGACGGGCATGACTCCATTCTTCGTGAGCTCCGCGCGCCACCCGCGTGTACCCGCTATGCTTGCTATGAGC
CAACCCACGGCGGCTCGTGCCTCTACGCTTGATGGGGGAGGAGCTGCCGCTAAAGACTCACCGCCAACCAAGACGCCGGCAGAGTCGTCGCCGGTCGAAT
CACCGGCGCCGCCACGCTTACCAGTGACCGAATCAAGCGCGAATGCAGTGACACGATCCCAACTGAAGAAGGCCCTGACTGCACCGCGCAGTGCGGTGAC
GCCGCTCGCAGACTGGACGGAGCGCACTCTGATCGATCCCGCTGGCGCACCAGCGACAAAGCAGCAACCGGCTATTCCCGCTAACTACGCACCGAAGTCC
TCAGCGGGCCCCGCAGACCACTCCGCGGTCTCCGAGTTTGTGCAGCAGCGTCAGGCAATCAAACGTTTCGTGCGGGACGCACTGCAAGCTGCAGTAGACA
AGCAGAAGGAAAACACAGAAAAGCGTGGGCGCAAGAACAAGACTTCATTTCGCACGGGTGACCGTGTGTTACTGTCCACCGAAGGCATCCGCTCCTCCGC
AGTGACCAACCTCGGTGCCAAGAAGCTCGCGCCGCGCTTCATCGGCCCGTTCAAGGTGATCAAGGTCCTCGGCGCCGCGTACACACTGGACATCCCGTCG
TCGCTGCGTCTTCACCCGACTTTCTACGTCGGGCGCCTCAAGCGATA