Description :
From Genome Similarity Track
Location :
Scaffold_84:70751- 72805
Transcript NameFunction/comments
Hyaar_Emoy2808612transglutaminase elicitor-like protein

Sequence
2054 bases(100 bases per row)
GCCAGCATAGATAATGGGCACTCGGGAGCCGTCGTAAAAGACCGTGAGCAGGGCCTTGATGTCGACTGGATAGAACACCACTCCGTTGTAAGTCACGGGA
CACCGCGGTTCCTCCTCCAGTATAGCAGCAGGACACCAGGCATGACAGATACCAGTCCACATCGCGGTGCATAAGCCCTGAGTGTTGGTGCTTGGCTTTT
GACGCTTAGCGCAAACAACATTTTCACCGTGACGTTGCTCGCAAAAGCTATTTTTCTCGCACTCAGATTTCAACGGCGAGCTCTCGACGCCGAGGTCCCG
CGATATGATGTCCATCATGGTTATCACGTCCAGACCGAAAGCCGTGGCGTATTTCTCAGTAGCGCTCACGTCGTTGTCTCTATAGTCGACATTGATGCAG
TCCTGGTACTTGGGCCAGTATGGACCAGGCCAAGGCGCACGCTCTTTGGCGCCCTCGTTAGGCAGGTTAGCGAGCTTCGTCTCCATCGGTCTGCCAAAGT
GCGCTTCCAGTTTGGCAAGGGCTCTGGCACTTGCGAATTCCTCAAGGCGGCGCTTCGCCGGTCCCTTGGCATCAGGCTTGGGCTCCTCCTCCCATCCAGG
TTCACAGTTTGAGGTATTCACCGCATCGTGCACCAAGTCCAACAACGGCGTCGTAGCGACAATGGCAGGCAAAGTTACCGGCATCGACAGAATGTCGGCG
ATGTAGCTATCTTGGTTGGCACCCTGCTGTAGACGGGTACGAGACAGAATGGGCGTGCCTACCTTGGCAAAAATTGAGTCCACGGGTCTCGACGGATTGC
TTGCCAGCAGTTCCGGGAACTTCGCGGGCACCTTCGGGATCGACTCGATGTTTGGCAGCGTTGGGTCCTTGGTCACTACGTAGGCCAAAGCTTCTGCCGG
CATATCCATACCACGGCCCGGGAAATCGCTACTCATCTTGTCGACTTCGACAGCAGGTTCAGCGCCGTAGAACATCGAGGAGGCCGCAGCCTGCTGCATC
CGGGTGACCAGTAGAGCCACGGCAGCAGTGACGAGGTAGGCGCTGGGTCTGTACACCATGGCGAAACCGAAGGCACTTCAGTGGTTGGTGTGAGGTAATC
GTCTGGTGAGGGAGGAGATTGGGAAATGAATGCAGGTGGTGCGAGGTGAAAAAAGCTTCTTGCTCTACCACGACATCCGACAAGCGTGTGTGGCGCGTCG
TTCACCATCGACGTGGGCAATCTTGTCGTGTTGTGTCGAGTATAGAGTTCGTCTTGCCTACGATGGTGTAGACGAGCGTGGCCACAAGAAGGCCCGGGCA
CGACAGCACGAACGTCGACACTATACTAGGAATGAAGGAAGGAGGGACAGGATGGGACTTGAAGGTTGGGCTTGCCCGGCCGTAGAAAGGGTAGGAAGGC
ATTAACTGGATTGGGAACCATTTGCTAATTTGAATTACACGGCCACAGGCTGTCAGGGCTATCCCTTACACAAGTAATCAAGGTAGAATAGACCTCAGAG
GTTGTTGCATTTAGGTGTGCACGCGTCGAACGTAACATGTGTAATCGGATACTGTCACGGGATCGGGGGGGGGGGAGTACGACATATGGACCTCGAACTG
TCTCGTTGTGTGTGGAAGTATCCACATCCAGTTTTGCACTAAACTCAAGCTTCAACGGTACAAAATACACTCTAGAAGACCTTTCAATCTGCCTCTTCCC
CCATCGACTCTCCCCTCTGCCTTTCAGGCCCACCCTTTGTCGTTCGACTTGCAGTGAAAATATTCGTAATCTCGATCCAGGTGCCTTTTTTTTGAGTCGC
TCGTGTCTTCGTGCTGATGGATTTTGTCACTAATACGGTTGTGCACGGCCATTTCTTTTTCGTGGATGTCGACAGACACGGTGGCGTCGTGTTGGGGTGA
CAACGTATCGTCTGAACGAGGACTGCATTCTACGGGCTAGTTGGAAGGTTTCGCAGTGTTCAGAAACGATCTGTGTGAGCTACTACTAGTCCACCTGTAG
TGAGGTGGTCTGTACTGAAGGCCCTGTTATGACCAGCGGTCTGACCCAGCTGAC