Description :
From Genome Similarity Track
Location :
Scaffold_359:7075- 13212
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_359-snap-gene-0.11HECT E3 ubiquitin ligase
Pytir_DAOMBR486maker-pir_contig_359-fgenesh-gene-0.2Eukaryotic translation initiation factor 4E
Pytir_DAOMBR486maker-pir_contig_359-fgenesh-gene-0.3Conserved gene of unknown function
Pytir_DAOMBR486maker-pir_contig_359-fgenesh-gene-0.8HECT E3 ubiquitin ligase

Sequence
6137 bases(100 bases per row)
GTTCAGTGTCCAGAACGCGGACGGCGAGGTTGTGGACCTCAAACCGAACGGGAGCGAGATCGATGTCACAGACGAGAACAAGATGGAGTACCTGGCGCTC
ATGCTTCGCTACCGGATGCTCGGCTCGGTCTCGGACCAACTGGCGGCGATGCTCACGGGTCTCTACGAGATCGTCCCGAAGAGTATGCTTAGCGTGTTCG
ACTACCAAGAGCTCGACTTCTTCCTCTCGGGTCTGCCCGTGCTGAACGTCAAGGACTGGCAGCTGAACACGCGCACGCTGCACTACACGACGGAGGCAGA
CATCCCCGCTTTGGAACAGGAGATCCAGGTCGTACTCTGGTTCTGGGAGGCGGTTGAGGCGTTCACGGACGAGGAGCGCGCTCGCCTGCTGCAGTTTGCG
ACCGGGTCGGCGCGCGTGCCCGTTGAGGGGTTCAAGGCGCTCACGAGTGCGAGCGGGTACGTTCACCCGTTCAGTTTGCAGCTGGTGCCGCTGGGGACCC
CGCCCCTGGGGATGTGTCCACGCGCGCACACGTGCTTCAATCGGATCGATCTGCCGGTGTACAAGACAAAAGAGGACCTCGTCACGTACTTGACTCTGGT
ACGTCCTATTAATCGTGCGGAATGTGTGCTAGGCTCACTAACGTTGTACTCTGTGATCCCCTCATGTTCTCTCTCTTTCAGGTGATTCAAATGGAGATTA
CGGGATTCGGATTCGAGTGATTGATCGCCTCCAAGATCATTGCTGCTGCTGATCAAGTGAGTGAGTCCTCAAAGCTCAGAGTGACGACAGGTGGTTCCTT
TGTACATTTGTTACTGTGACAGCTGCGTGTAAAAACTGTTGTTGATGTTGAGAAACGCATTTTCTTTATTTATAAAGGTTGAAGAAACGAGAGAGTGGAA
TATAAGTTGAAATTGGAAATACTCATCCGCAAGCTAACAGTGTTGCATGATTGCTCCCGATGCCACTCAATCATTCGCACACAACTGACCTCCACGCAAA
GCAATAGACCAAGCCGAACGCAAGAACATGCGCGTCAAGCACAAGAGGAAAGTGAAGAAAAGCTCGTCAGGCAGCGATCGCGACCGGAAAGGCTCAACGT
GCGAGCTCTGTGCCCACGAGGACGACACTCCGTGCGACGCATCGTGCGTGAAAGGGCTCGAGAACCCGCTGGTGACCAACACCGTCTGCTTCCAGCGCCG
GAGCCCGCACGTCACGGTGTTCTACTGTCAGTGCGCGCAGCTCTATGGCGAGATCCATCGCATGACGCTGCTCTCCGTGAACGAGAACTTCCAGGAAGAA
GTGGTGAACGAGATGGGTAACAAAGTGCTCGCCAAGTTCCACCAGGTGCTCGAAGATAATACAAGCGGTGGTGGTGGTGAAGACGACAGCAACAACCTTG
ACGCTCCTCCCATGTGTCCGTTCGTGATGCTGCTTTCTATCCTCTTGCCGTCGCTGAGGAAGTATCTAGACTGGGTGTTTCGCACTCGACCAGTCTGGGC
GTTTGGTGATGACACTACCAGTTTTAGTGGTAGTAGCAGCTCTTCGCAGTCCAGCAGCAGCAGCAATACACTCTTGAGCATGATCGCACTGCACGACGTG
CTCATGAAAGTGACGTTCGAGTGCGACAAGCTCTCGCACCTGATGGAGGTGAATGAAAGCGTGGAGCTGGAGCAAGTACTGCACGTGAAACCGACGCCTA
CCACTGTAATCTCAAGCGGAAGTAGCAAGAGTATCACAATGTCGACGTCAGCAGCGTCGCAAGCGAAACCGAGAAGCGTCCACTGGATCCCGCAGATCAA
GAAGATCTCGTTGGAGTTTGAAGATATCTACGCAGAGTACAAATACCAGCTCGCCGAGCTCACTGAGTCGATCCTGCAAACCACCGAGACGGTCAGTGGG
TAGTATACAGTGGCAATAAAAACTACTGATGGCGATTCTGAGTCTAACGACATTTGCATCTCTACCTGCAATGTAAAACCAGCACGCCAGCCGACTTTGT
CGCCCGTTGATGTCCAAGGATGCGTCCAAGTCGCGAGGGTCAGCTGTAAGTCACCTATGCGATGTCTTGTTGGTGCATCTGACAAAGTTTGAGCCCAATC
TTACCAGGAGCAACTGTGAAATCGATTGTGCATTTGCAGACTGAGTTTATGGAGCTGCTCGTGCTTCAGCTTCTGGATCCGATCGGGAAGCGCACGATCG
CCTCGCCATCCCCTTCACGACCGTATTTGTTCCCACGAATTCTCGAGCGGTGCATCAGCGTCGCGATGGAGTGCGTTTTTGGATACTGTTTACCATATCT
TCACCATTGTTACTCAGCGACTGACAAGTGCACGCATTTCGTGCTTTGCACAGTGAGTTTGTCTTGGACAATGGCAAGATGAACGAGATCCTGGCGGCGC
AATTCGAGAAAGGTGTCGCGTTCCTGCGCTCCTGGAGCCTGAAGCTCGAGATGGACTACAACAACCTGCTCAAGAAGAAAAAGATCATCAACCTCTCGAC
CATCTCACCGTGTAACTCGGATTCGCAACTTGCAAACGCGAACAACGGAAGATCAGAATCGCAGCAAACCGCTAATAGTAACAGCAACTCGGGTGCCTCC
CCGACGCTTCAACTTGTCACACTCGATGGCTTCAAGCGCCTCGAGAACGTGCTCAACACGTGGCTGCGCAGCGCAAACAAAGATGAGGAAGTGCTCTCGG
CACGTGTGCGCATGAAGGCGAACCTCGGCGGTCTCCGCACGACCATCGCGCGCTCGATTACCACCAAGAGCAAACAGATGAACTGAAGTGACAAAATTTG
GTTTGTTTGACAGATTGTTGTAAGCTACAACGTTTCCTAAATGCTTATATTATTCTCTACTGTTTGGGTTTTCATAGATCTTCTTTTTTGTATTTTCAAT
ACAGAAAATAGCTAAAAGTCTAAAAACGGAAGTCTTATCTTCACATAAACAGCGAACAATGGAAAATGTGTCAACATTCACCACACGCGACAATTCCCTA
AATACAAAAATCAAACACAATAAACACACAATTAATGCCTAAAATATCTAACTACCATAAACGCACAGCTCGCACTTAAACGAACAGCCTGTTGGATTCG
CACTTAAACAAGCGCCCTTACCTCCTCCCCTTTTTTCTCAACGGAGCGGAAAGCAAAGCAAGAGCTCACACGACCCGCACATCGCTCGCATTGAAAAGCT
CGGCTCCAGTGCGCGTGTGTGATCTCCATCTTTTCGTGCGTGTACGTGTGTGTCTATCTGCAAAGAGCGACCCAGCAGCACCACCAAACACCCAGCAGCA
GCAACAGAGAAGCAGCTTAAGCAACCACCAACCAGCAGCAACAGCAGACACGATGGCGTCCGGAGACGAAGAAAAGAAGCACGAGCTGCACACGGCGTGG
GCGGTCTGGGAGCAGCGCGAGCTCGGCAAGGGCATGGCGTACGCCGACAAGCTCTTCAAGCTGTGCACGTTCCGCACAGTCGAGGAGTTCTGGTCGTACT
GGAACAACATCCCAAAGCCAAGGTGCGTGTTGTGTGTGTGTGTGGCTCTGCAGCTTTAGATCCCGAAAGGAGAACGTGAGGCTGACAGCGTGTTCAGGCT
CTTGCTCTCTCTCCCTCTTTATGTGATTCTCTGTCCAGTGCACTTGTGCAAAATGACGATACTAAACGCGTTGTGTGTGTGTGTGCATTACAGCCAAGTG
CTCTTCGACGGCTTCACGAAGAAGAAGTTTGCGGACCGCACGGTCGAGTCCTTTGCGGTGTTCAAGGACGGCATCACCCCCGAGTGGGAAGACCCGGAAA
ACAAGCGCGGCGGCGAGTGGTCGATCCGAAAAGGTACTGCATGCATGGTGCTTTGGCAATTGCTATTGCTAATGTGCATTGCTAATGGTGTGTGTGTGTG
TGTGTGTGTGTGTGTGTGCGTTTGTGCAGAAATCGGCCCAGAGGCGCTGGATGAGTTTTGGGACAAGCTAGTGCTAGGCGCCATCGGCGAGACGATCGAC
CCGGGCAACGAGATCACTGGCGTGCGCGTCATTCACAAGGTACGCATATAGTACACAACAACTACATACTGTGCTGCCAAAAGTGTCCTTACAGAGCCGA
AGCGGAACGAAGATACTAAGTCGTGTGTGTGCTCGTGCGACTGACTGCTTGCATTCTGCAGAACAAGCGAGACAAGAAGGAATCGGGCAACAACTACCGA
TTCGAGATCTGGTTGCGCACGCCCGACCGTGGGCGAGCAGATGAGATCCGCGCGCTCGTGCTCACGTGCATCAACACGGGCAACACCACCGGCCAGCCGT
GGACAGCGCGCGAGCTCATCCACAAGAACCACTAGGGAGGCGGAGAGGGAAGAAAGGAATGACGGACGGACGGTGCGTCGCTAGCGACAGCTTCTTGATC
GTATTTTCGAGTGGCAGGATAACACAGGCACAGAAGTGAAGCGAGAAGGGAGGCAACGGCAACGCATCGTCAATCCCAAGCAGAAGGAGACCAGAGGGAG
AGCGTGAGGAAAAGAAGAGAGAGAAAGAAAAGCAGCAGCAGCAGCAGCGTTTACAAGGTCCCAAGGTCGCTTACAACGGATGAAGTCGCGCTAGATGGTG
ATTTATCAAGTTGGTACTAATCTAAATACCTGCAGAATAGGTTGGGGCTGTTTCTGCTGTGTCTGCGTGTATTTTTCTCATGCATCCGTAAAGCCTGGGG
TCCATCCAGTCATCCAGTCATGTTGTGGCACTTTTTGGATTTCGATTTCGGTCAATTGGTGCTTCAACAAATGGCGTGCCTCCCTGTTTGCCAGCCAATA
TTGAGCGACTAAGTTCGTATCTGACGTGCGCACTTAATGGATGTTTGCTTTGCATTTGTGTGTGTCAACTCGGCTGCACTTTCATTTTCCATTTTCCATT
TGCAATTCTATCGAACAGCTCAGCAGAATCAAAGACTAAAGGCAGCAAGCAGCATGTCGATGTGGAAGCAGCTCTTCTCGGAGGCTCCGCCGGGCGCCAT
GGAGTACGCACGTGTGCACGAACAGCCCTCGTGATATTATTTATGTATGGCGCTTACTCACCACATGTGCGCTGTTTTCCTCTGCTTGGTCAGGAACCTG
CTGTCGCCGAAGCGCAAGTTCTGGTACGCCATGTTCGCGCTCACACCAGGCACGCTGCTCGCGCTCTTCCTCAACTCGGTGAAGAACGACATGGAGCGCG
AGAACGAGGAGCTGCGACTGCAGCACATCCAAGAGGAGCTACAGGTGGAGACCGAGCGCGAGCAGAAGGACGTGCTGCTCATGGGCATGATCCAGGACCT
GCGCAGCCGCCTCCAGTCGCTCGAGCACGAGGTGGCGGAGAAGAACCGAATGCTGCAGCAGGCGAAGAACGGCACAAGTACAAGCACAAGCACAGCAGGT
GCAAACACATCGGTAGAGACACAGGCACCTGCAGCGACGGCCAACTGGGAGAAGCAGAAAGGTGCGTTCCTGAGCTCCTCGGCGGCGTCCGCAGCAGCAC
CATCAGGTTTCTCGGAAGCGCAGAGCGGCATTAACATGCGCGTCAAGCAACGCGAGCGCGACGTGCTGAAAGAAGACGTGCGCGCGTACAAAGCAGCGAG
AGACAGCAGCAAGACCACCACCAACTAGAAACCCATACACGTATTGATTTGATTTTATCTGTTTGCTTTTATGCCATGCTATCTGTTTGTTCTTCTCCAT
ACAGATACAGATACATTTATTATCATCCTCCTCCCTGTTTCGCATCATTATCATAAATTCAAGCCCTCCACTAATAACGAGGCGTATTGGGCTCACTGAC
TGGTACACAGCACGCAGCGTTGCTGCAGTACTACTCCAGGCCAAAGCCGATGATCTCCATTTGCGACACCATCGTCAGGTATGTCTCCATCTCCTCCATG
CTGCGGTAGAGCGGCAGATCGAGGCGGTTGAAGCACGTGTGCGCCTTTGGGAACAAGCTCGACGCGTCATTGCCGCGCGTGACCAGCTGGATCGTGAACG
GGTGGATGATGCCACTCGAGCTCATGAGCCCCTTGAAACCTTCCACGGGCACGCGACTCGTGCCGGTCGCGAACTGCAGCAGGCGCGCGCGCTCTTCGGC
GGTGAAACCCTCGATGATAATCCAGAACCACGTGAGT