Description :
From Genome Similarity Track
Location :
contig_24:707452- 724564
Transcript NameFunction/comments
g5798.t1RAW38745.1 hypothetical protein PC110_g5017 [Phytophthora cactorum
g5799.t1hypothetical protein
g5800.t1hypothetical protein
g5801.t1XP_009529817.1 hypothetical protein PHYSODRAFT_346765 [Phytophthora sojae
g5802.t1XP_008904693.1 hypothetical protein PPTG_10931 [Phytophthora parasitica INRA-310
g5803.t1XP_024572550.1 protein-l-isoaspartate o-methyltransferase [Plasmopara halstedii
g5804.t1XP_009529821.1 hypothetical protein PHYSODRAFT_354854 [Phytophthora sojae
g5805.t1XP_009529822.1 hypothetical protein PHYSODRAFT_560612 [Phytophthora sojae

Sequence
17112 bases(100 bases per row)
GTTAAACTGAGCTGGTGCAACGACGTGATTTCTCCGCGCGAGACGGCGGGCGAGATCTCCGTCAGCAAGATGGGCACCGTGTTGGTCACGACGCCCGACG
CTAGCCCCACGAGCAGCCGGCCGGCGTAGAGCTCACGCTTGGAGGTGGCAAGCGCGCAGACGGTGCTTCCGACAATATACAGTACGTTGTTGACTAGAAT
GGTCTTCTTCTGGCCCACGCGCGCACCCACCCCGCCTGTGGTAAGCGCCGAGAGCACGCAGCCGACGACCACGAGCGCCGTGGCGAGCTCCTGCTCCTCC
GTGCTGAGGTTGATGTCCACGAGGATGGAGCCCACGGCGTCCGGCATGATGCAAACGTTGAGCACCGCGGCGCTGAAGCCCCACATGAAGGATGAGATGG
ACACCAGCCACGCCGCGAGCCGCAGTTGACCCGTGCGGCCGCAGCCCACGAGAGACGCCTCGGGACGGACGGGCGCAGCGCCAGGCTTCGTGGATGCAGC
GGAGCGACCGCTGCCTACTCGCAGGCGCTGGCGCTGCGGAGATACGGGCGCAATCTTGGGCAGGAGCTTCTCGTGGATGTCGACGTGGGCCTCCATGAGA
TGAAGGCGATGGTTCTTCCGACGTTTGCTTCAAGGAGGAAAAGATGCACCACACTGTGTTAACACGAGGTTGTGTGTCCACACTAGATTCAGATGGATGC
AATCGTTGGGCCAGTCATCAGGCGCGTGTCTTTGCGGAGAGCGAATCCGATGGCGTGCTGGCAGTGCTGTGCAAATGCAGGGCAAGCCTTTGATGCGCGG
GGCGTAGATGCCAACGCTTTTGGGCCAGTGGTGCGTAGCTTTTGGGCCAGCATCTTTTGGTGCTTGTAAAGCACTGTTTCATTTACATTTTGTGTATTAC
ATTGAAATGGGCCTATTATTGTCTGTTCCAGGACGACGCGACAGCGTGTTTCGACCGCATAGATGCGCGACAATTTTACAGTACAACTTCAACAATTACC
GCGAAAAGCTCATGTTCGCATAAACCTACCAGGCAAGCTCGTCTTAACATTGAAAAGTCTTTGGAGCGGTAGTTATGTGTCATCCCGGGCCGTGATTCAC
GGCTCGCTCCGCCCCACCACCGTCGGAGCACTGCCGACTGTATTGCTGCCGGCGATGCGAGCATACCGGCGGGCGAACTTGCCAAAGAAGCTTCGGCTTT
AATAAATCGACGTCTGCTTTTCATTGCGACTGCAGCCGTCTAACGACATCCGTCGCGTCGAGACGGCAGCACCGTGTCGTCATCGCCGGTTTACCAGTGT
AGCAAGCGTGCATTTCCCGGGATCCAGTCCATGCAAGCCTGAACAGCGCCTAGCGCAATGGCACAGAGCGCGTTAACTTATGGCTGGCGGCAGTCTCTAT
CTGGCATCTTTACATGGAGTAGCAGTGCTGCTTGGGGGGCCCAAGTAACGTAGCAAGTTGAGGCAGCACCGACAAAGCCACAATAGTTGCCAGCATTAAT
GCCAGCACTATTGCCGGCACTAATAACAGCGCTGAAACGCCAGCAGCATGGTCCAACGGCGTTAGGCTTACGGCGTTAGGCTTACGGCGTTGGGCTATTC
TGGACTCGGCCTGGGACCCCGGGCACGGATGAGTGACCATGCCTTCCATGCCGAGCTCGCAAGCACTGCAGCCGCGGGCGATAATCATCCAGATAGGGTG
AACGAATTGGCCGGTCGACGCCGTGCCCTGCAGCGCGCCAATTGCAACCAAATCGTCGACAAAATTGCCTTCGGCGAGATCCACAGCTGCCTCTGAAGAG
GTGCATGCGCTGTTGCGGTTTCTATGCGTTGGACCTGTCTCCGCTTACAAAAATCAAGTCAAAACCGCCCAGGTCGGGCCCTAGTCCCTGCCCATCTTGC
TGACTCTCTCGCTGCGATTCGCGCAAAAGCGGTCGAGGCCTGCTTTTCGTCCAATCGGCGCGCGGCACGACCGTCGGCAGGAGCCCCAACCCGTTTTATC
CTTCTCGCTCCAGCAAGCAAAGGTCCACGGAAGAAAAGCCGATAGGGAGCCGCGAGCCCGCTAGAACGCAAAGTGCTCGAAACAAGAGAGAGCAGAACAG
GAAAAACAGGAAACAACCACCACCATTGACTCCCAAGGAGCACGAGAATGTGCCGGCCGATAGAGTCCCGCGATTCGCTGGGCGCCATGGGCCCGGCCGC
CGTCGCGCTCTTCGCTGGCTACCAGCCCTCCGCCGCCGTCGCGGCGACAAACAACAAGGCCATGCTGAGCCAGAACGTCAAGGCCTCGGGCCGCGCGCCC
GCCTGGTCCACCGCCGGAGACTTGGGTTTCGGCGCGGACGGCATGAACATGCTGAGCATGGCGGCACCGCCCCCGGCACTTCCCTTCGTGTCCTTCCCGA
AGCCCAACAGCCTGCCGGCCATGCCGTGGGCCGCCGCCGCCCCTTCGACCGACCTGCTAAGCCTGGGCCTGCCCAGCGACCAGTTCGCGGCCGCCGAGAC
CAAGCCTGAGGCCGTGCAGCCCAACTTTGAGGCCCAGGAGCTCGAGGAGCTGCTGGACTTCTCGATGCCCGGCGAGATGGAGAGCGTGAGTAAGGACAAG
CCCGACCTCGTGAACCTGGACGATGGCTTCGACGGCACGGAGATGTCGATCCTGTACAGCTTCCTGGTGGACGCGCCCGAGGACAAGGCCAAGCAGACGG
CCGAGATCGACGACGGTATCCTGAACCTGAACGTGCTGGCGGGATCCCCCATCGACGGCCTTATGGAGTCGTTCGAGAGCGACTTCACGGACTCGGAGCT
CATGATGACACCGCGTCAGCCGGAGCCCCACATGGTCGGCCCCAAGACGCTCAAGCCCGGCGAGGTCAAGAGCCGTCGCCTCTGTAAGAGCGAGGGCTGC
TACAAGCGCTCGCGCTCGAACGGCCTGTGTATCTCGCACGGAGGCGGCCGTCGTTGCGCCGTTGAGGGCTGTGACAAGAGCTCGCAGGGCGGCAACCTGT
GCATCCGCCACGGCGGCGGCAAGCGCTGCAGCCACGAGGGGTGCGACAAGGCTGCGCAGTCGAACTTCCTGTGCAAGGCCCACGGTGGCGGCCCGCGCTG
CCAGTTCGCTGGATGCTCTCGCAGCTCGCAGGGCGGTGGCTTCTGCCGTTCGCACGGTGGCGGCAAGCGCTGCATGTTCGACGGCTGTGACAAGGGTACG
CAGCGCGGCGACTACTGCGCTCTCCACGGCGGCTCGCGCCTGTGCGAGGTGCCAGGCTGCATGCGTAACGACCGCGGTGGGGGCCTCTGTGCCACCCACG
GTGGCGGCAAGCGCTGCACCATGGAGGCCTGCAACAAGCCGTGCCGACGCAAAGGCCTGTGCTCCGCACACCTGCGCCAGGTGGAGGGTACCAAGTAAAG
GACGGGTTGATCGAGTGGAAGTCGCTCCGCCCTTGCCGAAGTGAAAGACGAGGAGAGGACGACGGTGATGGTGGGACGACGACACGGGACAAAGAAGGAA
ACGAGGAGGGGAAGGGAGCGTGGGAAGGAGGAACTGAGGGTGGAAGGGAAACTGACGGGTCTAGTGGCGTTGGAATCCTTTGCTGCCACTTGGTCGGTCG
AAGTCGAGCAGCGGCTTCAGTCTCTTTGCGATGGAGAGCGACTTCGGCCGACGGCAGCAGGGGAGGCTCTGCATTATTCATATGGTGTATAATTGGCTTG
GCGGATGCGTGCGAGCGTGGTCCGTTGCGACGAAGGAAGGTCAAGAGTCATCGAGTGGTGGCGGAGTCGAGTGGCTGTCCCGACCAGTTTTTCCAGGAAC
TGAAGGGGGTTGAAGGCTGGCGAGACCAAAGCTGAAGGTGAGTCGGCTCAGCAAGGGATGGTCGTTGGGGCCCCATTCGAGCGGTGCTTTGGTTCTGAAG
CGTTGGCGGTGCGCATGCTGCTCGCAGTCCGTCAGCTCTTCTTTATTTACAGCGAGGAAATGTTGGAGTAATGCCATTTTGACCTTTTAATAGCGTGGTG
TTCAAGTCTCATATATAGTAGCAATTCTTTAGTGCATGCGTTCTTATGTGTACTCGGCTGACTCATCTACCAGCGCTGGGCTGCACACGACACTTGTCGA
GTCGAGTTGGCGGGCGCAAATAGGTGCCCGCACAGTCGGTATCGCGTGCAACCGCCAAGCGCACAGCTCCATGCAGCGATACTGTTCTTTTCGAGACAAG
ATCTACACGACGACAAGAGCGGCGGAAACGCGACCGTTCAGATTGCCTTTGCCCAGCAGCGCCTGACCAGCGACGTGGGTGCGGATTCAGTGCGGTGGCC
CATGTAGCGTGGCGTCAGCGACGCCCAGCTCAGCGAGCGAGTCGCTGAGCTGGGCGAGGACAGCCCCTGGCCTACATCGCGCTATGTTGCCACTGGCCAT
TACGATCACCTCGGGCGCCGATAGAGCTTCGAGCGTCATGAGCGAAAGCACTATTCTCCGGTTGAAGTTTGTTCGTGGTCTCATTTGTTTGTGGTCCCAA
TATAATAGAAAAAATAATGGAAACATAAAAACAATTAATATACCAAATACGCATATAGACAATATTGCTACTTTGGCGTCGTCCACAAGGCCAAGCAATA
CAGGTATGGCGGGACCCGATGCGGACGATGCGATGCCTCGCGCCAAGCGGCTGAAGCTGTTGCGCGAGGCCAAGATCCGCAAGGAGCGTGGCGAGAGCAG
CAGTGGCGAAGCTGGCGCACTGGTGGTTGCAGGGGTGAAGCCCGTTGAGGACGAACCAACGCAGCCGAAGGACCAGGAGGACACCGATATGCCCGACGCG
GACCAAGCTCCTGACAAGACAGAGGACCTCGTGGAGAAAGTGGCTCTGGCGCAGGAGGAGGACGCCAAGACAGAAGACGAGAGTGAGGACGAGCTGCTGA
ATTTGGCGCCCAAGCGCGCCAACTGGGACATGGAGCGCGACATCGCACCCATGCTGCGCAAGCTCGAGAAGCGCACGCAGCACGCAATCGTCGAGATCTT
GCGTACGTTTGGAGCTCAGCTTGGCACGTTGTTTTGAATGCTCATGTGTCTAACAATGGCTCTGCTGGAATTGCAGGTGAGAAGCTGGCAGCAGAGCAGC
AGGAGGAAGACGACGATGACGAGGAAGAAGAAGAAGAGGAAGACGAGGAGGTGGAATAGCGCCGTCATTTGCAGTGCAATCCTATGTACTATGATATAGC
GCTTCAGTGCACCGTCTGGGACCAGCAGGGTTTAACCTGGTCACCTAGGTGTTCATTTAATGTCTTCGCTTTTAGCCTTCTGCTTTTTAAGCTTCTTCTT
GTCATCCTTGGATCCGTTTTTGCGCTTCTTGTCCTTCTTTTTGCCGTCCCCCTTCTTCTTCTTTTCTTTCTTCTCGTCATCCTTGTGGAACTGCTTCAGC
TTCTTGTATATCTGTTTGACCTGCTTGCCGCGATGCTGCACGGCTTGCTCGCCGCCCTTGTCTTTTTCTACTTTCAGTGCTTGGAATGCCTGCTTAATCT
GCTGAAATCGACCCGTTACCTCGTCGACCGGCTGGTCCTTAGAGAACTTGCTGCGTTTCATGTAGTCCAGTACATCAGCACTAGTGAGTCCGCACGCCTT
TTCACCGCTGCTAGCAGCAACCTCATCCGTGACATGCCATAGCGCTGCAAGCGCCAAAACCGACGGGTAGTGCAGCAATGGCAGGTCTGTGAGCAGCATG
TCATTGAGCAGTGCGGTCGAATTGGCGTGCAGCTTTTGCAGGACGGTCGCAGGTAGATCCTTCGACAGCACCTGCTTGGCGAAGGCGCGGAAGTCGTCCA
AGAAGCCCAGCAGCGCACGGAACGGGTGATACATGATGAGCTGGAAGCGCACGCCCTCAAGCAAGATCATCTCGTGGCCAATGATGAACTTGTGGTCCAC
GTGGAGCTGGTCAGCAACGGTGTCCACGGACATGTACTGCTCCTCGACCTTTCCCGCCACGTAGATGGCCGTAGGGACGAGAAACTTGGGGTGGAACTCC
ATCACACTGTTGCTTAGATAGAACCTCTTGAATAACAGCATGGCGCAGCACTTGACCTTGTCTGAAGTGCGCAGGAACTGGGCGCTGCAGCTCTCCTGGA
TCTTCTCCTCGTAGAAAGCTCGGAGCAGCGCCTCCTGTTCCGGATTCAGGAACTCCAACAGCGGCGTCAGTTGCAGATTGGCCTTCTCCTCCGCCTCCTC
CTCTGTGCTCAGATCCATGTTCACCTCGTCGTTCCAGTCGAAGGCGTCGCGCACTGCAGTGGACGAGCGCGGTATTAGAGCCGAAAAAGACCGCGCTTTG
CGGCTACTGGCGGCCGCCGCCTCAACCTTCTGCGTTTCCCCGCGCTCTAGACGCAGCGCGCGCTTCGTCTTCACATGCTGCAGACGACGCACACGCGCCA
GCTCCTCCGCCGAGAAGACCCAGTTGTTGAAATGCGTCGACGTCGAGAGGTACGACATGCTGCCGATCTGCCGCAATTGGAGTGCTGCGGACGATATGAC
ACTACATGGGGTATGCTATATTAAAGGTGAGTGTGTACCACACCATATTGAAGTTGGGTGACGTCGAGCGCATCGATGATCTTCTCATCACTTGAGTTTT
GGCCATGTGGGGCGCTCGTTTCGCGCTTCGCCAGCCTCTCGGGGCCAGGAGCTGCTCGTCACCGCGTGTAATGACGGCGAGGAAGGTGGCGCTGCAGCAG
CTGCCGCTCGTGGACGTATCTCCGCTGGTTGCGGCTGCCAACAGCGGCGGCGAGGTGCCACCCGAGACGAAGGCGCAGATTTTGAGCGACATGCGCTCAG
CATGCATCGACACGGGCTTCTTCACGGTCCCCACAAAGGGAGTGCTGTCCAGTCGGCTCGTCCAGGCGGCATACAGTCGAGCTGACGAGTTTATCGCGTT
GCCGGACTCGGTCAAGCACAAGTATCACTGCAAGCGCTCGCCCAATGCTCGAGGCTGGACGCCCATGTTCGAGGAAGCCATCGGTGCGATAGAATTGATA
TTGCTATGGCAGAAAGGATAGGGTGTTGATGGCCTGGTTTATGCTGCAGTACCAACCGGATGTGGTGTCCCACTTGGAAGGCTTCGATCTCGCCAGAGAG
CTCCCCGAGACGTACGTGAAGGAGGGATCGAGCTTGGGTCCTAATGTCTGGCCAGCTGAAGTGCCACAGTTTCGGGAGGACGTGTACACACTGTATGAGG
AGACTACCAAGCTTGCGACGGTGCTGTTTCGGAGCTTTGCCGAGATGTTCGGCCTTCCATCGTCCACGTTCCTGGTGCGAAAGCGATTTCATATACTAAA
GCTGGCGATAGACGGTAGTGACTTTCTTGATGCTGTAGCAACACGTCGATGAAGAAGCTGAAGCTTTCATGCGGCTGCTCACGTATCCAGAGATCGAGGC
GCCTGCGAAGAACTCGACGGTTGGGATCGCCTCACACACCGACTTCGAGTGTTTCACTATCATTCACCAGAACGGCGAAGGACTGCACTTGCTGAACCGC
CAAGGCGTTTGGGTCGAAGCACCTGTGTGCGATGACAGGTACCAAAAGACTTGGCTCACGAACCTGTCGTTGGACTAACTTGCCCTGTTTTTTTCTACTC
CCAGACTCTTTATCATGGTTGGCGATATGCTCGAACACTGGACTAATGGCGCCCTAGTTGCTACAGAGGTAAGCTCCGCAGAAACGACGAGTCAATGCTT
TGTTTTGATCTACATATATCTTGTCTGCAGCATCGCGTGTGCAACTCGGAAAAGAAGCGCCAATCCATCGTGCGCTTCAACGGCGCGAACGGTGACACGG
TCGTGGAGCCACTTCCGGCCTTCGTGACACCAGAAAATCCGCCTCGCTACGCGAGAATGACGCAGCGCGAACACATTACCCACCAGATCGAACTGGCGGA
GCAACTTCTGCAGAAAACCAAGGCCGCGGCGCATGCCTGATGACACAGGTCAGCAAACCTCACACACGATGAAAATGGCGTCGTCAATAGCCGATAACCG
TGACATTGACAGCTTGATCCCAGTAATCTTTCCTCTACTTTCGCAGCGCTGCGAACTCTTGGAACAGCTTTTTCGACTCAGCATTGCTCATAAGATCATC
TCGCGTGGGCTTCCGTCCGTTCTTAGCTTCAAAATCCTCACGCCACTGGGTAAGGGCCTTCTCCACGCGCGTGAGTTTCTCGGTGCGCGTCTCCTGTACA
ACCTCCACGGGCACAGTGTCGAGTATAGGCTGGCAGAGAACGCTCATGATATCGCGCTTGTCTACAGTTCCATCAGCATGCTTGGTCATCTAAAACCACA
ACGTACACGAATTTATGAGCTCAGTGCAATCCCTTCCTCGTCGCTCCTCTTTACGACTCTCACCTTGACCAGCTTCTGCTCTGCACCCGCCCCACCAAGT
GGGATCAAGAGTCCACCTCCAGGCTTCAGGTACTCCAGAAAGCTCTCGGCTTCAGCCTTGGTTTCTACGGCAACACCGACATGGATGCAGTCATATCGAC
CATGCGATGGGAGGCCGAGGTCTCTCTTGCCTGTACTCAGTAAGATCTCTGTCTGCTTCTCCGCGTCCTCTTTACCCAAACTGCGCTGCAAATTCTGTTT
CGAGAACTCCACGAGCTCCGGCACAATATCAACGCCCGTGACAAAGCCCATAGGCCCCACCAAGTGAGCCATAGCAGCCACAAGGATGCCTGACCCGCAG
CCCACGTCCACCGCAGTCATCCCTGACCGCAGGTGCTTCTCCAACAGCCCCAGCACCTGCGCGTGCTGCTGCGGGGTGGAAATCGTCGCTACCGAGCCGA
TTTTCAACGGGCGATTAGCATAGCGATCGCTCGAGGCTCGAAACGCGGGTGCCACGAAGTCCCCACGGTCCACGCGCCTCAACGCCGCCTCCAGTCGCGA
GCCAGAAGCCACCACATTCGTCCGGACCAAACTATCCACCAGCGCAGCGTGCGAGTCGCCACCGATTTGATGGCCGATGCTGGTGCTCACAAGCAGGTCC
TCCGAGATGCCACTTAAGACGCTCAAGGGCGGGAGGCGCCTGCACGAGACGAGCGCCACGGCCGGAGCAGCGACGACATTCCTGATCAAAATCTGAGGTG
CTGAGAATATAGTCCAGGAATTTGTAAAAAATAGTCTTCAAATTAATAACAGCTCAAATTCATGGTTATAGTTTTGGGCTCTACACGATTGGAACGGCCC
AAGCTCCGTGGCTCTCGATGTTGTAAATGTTAACGCCTCTCGGCGAGGAAGAAGCCGCGGTCGCCCCAGTTTGTGCCGTCCGAATTGCGGACGACCCAGT
ACTTGACACCAGTCTTGGCGTCGGTGCCCCACCCGACAAGACTCACGACATGGGTCGTGCCTGGGTATTTCGTCGAGTCACGCAAGATGTAGCCTCCTTT
GAACTGACGGTACTCAGGTGATAGCGAGTACATGCTCACAACAATCGGGCCACGATGGTAGATCTCGTTCATGGCCTGCAGTTGGAACTCCTCGGACGTC
GTGAAGTTGAGCGTGCCGTACTCTGAGATGCGGTACTTTACCGGGTCTTCGAGCACGAAACACTCACCCTTCAGGTTGCACGTGTGGCACTGTGTGGCAG
CACAGTCGCCGCCGCCCATCCAGGACGGGTGCGACGCAATGTATGGGTTACACGTCAAGTCCACGATACCATTCTCGTGGATCCACTTGTGTGCATGCCG
CGGGTCTCCACCGTGGCAAGAACCAAAGGATCGCATGCCACAGTCCAGTAGCACCTGAGGCGACAGTAACACCTCGGTGTCGAGTCGCCCGGTCTTCTTG
AACCGCGCGATGCGGATACGGTCCGACAACGCGCTGACTGTGGCGAAAGCCCAGCACGACCCGCACGCACGGGGCACCATTTGGTTCATGATGCTGGTGG
TGAGGCTGATACCGGTGCCGTTGTAGTCCCGCCAGTCCCAGTTCTCGGGCAAGTCGTCAAAGGAGCGAACTTCCTGCAACGGTGTCAAAACGTGTTCGGG
GTCGTTGCCGCCAAGGAACCAGCCGGCTCCTTTGTTCGTTTGGACCGTCGCAACGCCACCCTCGCCGGTTTCAGTGCCAGCGGCAGCACACGCCGCCATC
AGATCGAGCTGGTCTTGCACGGCGTGCATCGCGACCCCGTCGTGCGTGTAGTCGGCGAGTTGCTTGGGTGCGAGCACCGCCGAGTTGACGAAGCATCCCA
GCACGATCCAGCCGAGCACTGAGCCAATGGAGCGCAGTCGGAAGCGATCAGCTCGGAAGTTCTCCCAGCTTGACTGCAACAGCGACGACGTTGAAGTCTC
AGGACCGTTGCTGGGGCTGAGGAGCGTGCTGGTGCGTGGCTGCAACAGCGGCAAGTCGGACTTGTCGGTGATCGCCATGGGGCTGCTGGAATTGGTCTGG
AGACTGCGGGAGAAAGTTGCAAAGTGAGCCGCGTAGGGCTGCAGAGGGTGAGCCATGTTCTTCCAAGTCTGACGAGGAGCTCTTCTCGTCTGTTGGAAGG
ACATCATCTGCTCTGTTGGCGACGCGACTCCATGTGATTGGCCGAGCGAAGCGGCGTGGACCAATCAGTGGAAAAAGAACTTGATCTTGAAGTAACGGCT
CGCTAGGATGGATACACAGGGGTGATCGACGCGGGAGGGACAACGCCCAAATCTTAAAGCTGGTGATGGTGCAAATATGATGCAATGGTCAGGCATGCAG
TCAGGCACTCGAGTTGTTGGCGGCGCCGTCCCCGCCCGCGTCCCAAGCAGCCATTGCGACGGGCGTCCAATGGTCAAGAGCTCCAGGCTCCAGTCACGCA
CGCTACGGAGTTGATGCTGACACTGCCGTCGACGCAATCTGCCGCGTTAGGTGTGGGTCAGGTCGGCGAGGAATTTCGTGTCAGGGTCCCCGCTGTCTGC
GGTGTCACGATTATGGACGTCTTGGAAGGATGCTGTGCCGCACAGTCATGCTGCAGAGAATAGGCACGAGTGCCTGACCAAGGCAAGAAAACCTTGCTCG
CTGGGCGATAGAGTTTGTACCTGAGTGATGGTATGGTGTTTGGTGTTGAATGTACACAGTCGCTGCGCTGCGAATCAAGTGGAGATGATGTTTTCTAGTA
CTTTTTAATCGTCTCCTCACTGAAGTTTCCCACTGTCGACAATGGTACACGGCACGCAAGGCCGTTCCTGGCGAGTTTCCAGACTCCCGATTGTCATGAT
CGTGCGCCATCCGCTTACAACTCGGCCAAATGCCACTGCAGGTCATCAAAAGCGAACAGTGTACACGTTAGTTTCAGGATCGGTGAACTTGGCAAGAAAG
ACAATAACTTGCAGTACCCTTACGGCGATCGAGCCACGGTTGAGGCGAGAGGGTGATGAAGAATTGGGAGCCGTTCGTATGTGGGCCTGTATTTGCCATT
GACTGCAAAGAAACTCGTTAGACCATTTGTGACTGATGGACGAAGGTTAGTTTGTAGGTACGGACGTACAAGGATGCCAGCAGCGCTATGCGAGATAGCG
AAGCTCTCATCACCAAACTCGAGGCCGTAAAGAGACCGAGAAGGCCCGTCTCCTCGACCATTACCAGCCACATCACCAGCTTGGATCCAGCCGCCACGTA
CAACGCGGTGCACCGGGTTGTCCTGGAAGCCTAACTGTTGTGTTTCATCGTTGATGTCAGGGACCTTGTGCTCACAGAACGCCAGAAAGTTTTTACATGT
TTTGGGGCACACGTCCTGGTAGAGCTCAAGTTCTACCCGCGGCAGCGCCACACCATCAACTTCGAAGACCAGAAAAGCATACTGATGTCCAGACGACTCG
CGATAATGAGCCAGAGCTTGTTGGGCTGCTTCCTCCGCTTTTGCCTCCAGCGTTTCTTCCGCGAGTGCCAATTTCTCGTTATACTCTTTCCGTGCGCTGT
CATTGCCATCGCTATCATTCCCGAGCACGGGCATCCCATCAAACGCTGCAGCGGCTAGCAATTCATTCCTCGAGAGTTGTGTCCGTTCCATTGCGAAGTC
AAGCAAGTCGTCTTCGCCGTCTAGCATGTCGTTTGAGGAATCCAACAACAGTATGATTGGTCGAGTCGTTCGAAGCAGCTCTGCACGCCCGCTCTTGGGG
ATTTTCTCCTGCTGGTTTTGCAAATACTCCAGGTATTCAATCTCCATCATCCCTTCCAGCGGAGACACGAAGATTGGGTGCAGCTTCCGCAGCTCATGGA
GCAGCAATCTACAACGCTGGTAAGCCACGTCACCCATGAGACCCACCAGCTCGCAGCACTCCATTACAGCCCCGCCTGTCGTCGCCATGTTAAGACACTA
CTTTGTCTGCTTCAAACTAGCACAAATGCCAACTGCAGTCCGTTTGCGTCGCGTCCCCGCAGGTTTATTTGCGGCACAAATGGGATGAGCCTGAACATAC
ACAACCACCCCAAACAAGCACAGCATCAACTTCAAGATACAACCCACCATGCGGTGTTCATTTCCGATTGTCTCGTATCTGCTCTACTCGGCCACTCGAC
TCGAATAAGATAGTTCGAAAACGCGCACATCGGCGCCAGATGAGAATGCCCACAGCACGTAACAGCGCTCCGATTTAAACCTTGCTGTAGTCCATCTTGG
ACTCGAGCTTCTTGGTCTCAGCCAGTTTCCGCGCAGCCTTCATGAAGTCCTCCTCCACAACGTACTCGCGATCAGCGCGGATAGCGAACATACCCGCCTC
CGTACACACGTTGCGCATATCGGCACCGTTGAAGCCATCTGTGAGCTTGACAATAGACTCGTAGTCAATCTCGCCCTTCTTCGTAATGGGGCCAGAGTGA
ATTTTGAGAATATCCATGCGCGAGGCCTCGTTAGGCAGCGGGATCTCGATCTTTCGGTCAAGACGACCAGGACGCAGCAGTGCCGGATCCAGAATATCCG
GTCGGTTCGTAGCCATGACCATCTTCACTTGTCCTAGAGCGTCGAATCCATCCAGCTGGTTCAGCAGCTCCATCAGCGTACGCTGAATTTCACGATCCGC
CGATGTGCCTTCCGAGTAACGACTTCCACCGATAGCGTCGATCTCATCCATGAAGATGACACACGGCTGGTGGTCTCGGGCGTACCCGAACATCTCACGA
ATCACACGGGCGCTTTCACCGATGTACTTGTCCACAATAGCACTAGCCACGACCTTCAAGAAGGTGGCGTTAATGTTGCACGCGAGTGCACGCGCCAGCA
GCGTCTTGCCCGTACCCGGCGGGCCGTACAATAGCACACCCTTGGGCGGCTTGATACCAACCCGCAGGAAGAGCTCCGGGTTGGTGAGCGGCAGCTCGAT
GACCTCACGAAGTTCGCGGATCTGCTCGTTCAGTCCACCGATGCTCGAGAACGACACGTTGCCCGCGTCCTCATTCAGCATGTGGTACACTGTGGGGTCC
ACCTCACGCGGCAAGTAGCGCATAATGGTGAGCGTCGTCATGTCCAGCGCCACGCGCGTACCCGACTTGAGTTTGCTCTTCTCCACCTTGGCGCGGCATC
CCACGACGTAGCGCGGGCCGCTCGACGCCTTGACAATGAAACGGTCCTCGTCTAGCTGCCGCAGCACTTCACCAATGATTTGGCCCACACTCTGTAGAGA
TAAAACGTCGTCAGTTAAGGAGATAACAACGTTTTAATAGAGTAAGACTGCACCTGCAGAGCCTTGAGGTCATCCTCCGTCTTGTTGAACTCCTTCACGA
GCGTCTTGACGTTCTCGCGCATGTTCTTTACCCTGTTTTACATGGGGAAATGTCGGTAAATCGTGAGTAAATAGCAGAAGAAATTCCAGCAAATGAAGCG
AAAGATCGCAAGCGACTGAACGAAGGACATAGAGCGCTATAGAGAGACATGTTTGCATGCAAAGAGAGCCACACACCTGCTCTCCATCTCGCGGTGCTCC
ATGACCTTGGCCTTGTACGCGTTGAGCACCTGCGTGCGCTCATCTTCGGTCGGCACGGACGCCATCTTCGCCTCACTGCTTCGAATCGAGTTCTCCCCTT
TTTGGATACGGCACTGAAAATCACCCAATCAAAATCGCATAGATATCTAATTGGCTGAAAATACGCCTGCGTCAAGGGGCACATCTTGTCCAGCTAGCGT
AACCGCCCATTGATACACTCGCCGCGCGAGACTACAGGTAACAACTCAGACATCCAGCAATCAAGAAGTCGAGCGCCATGGATCGATTCCTGCTGGCTGC
TGGCCGCGTGAAGCCTCTGTCGCGCTGCGAGATCGGTGCAGGATCCTTGAAGAAGTGCCTGACGCTGGTGGATCTCGTAGCTTATGGCGTGGGCTGCTCT
GTGGGCGCTGGCGTCTACTCGCTCGTGGGTGTCGGCGCTCAGATCGCGGGGCCGAGTATATCGCTGTCGTTCCTGATCAGCGGCCTCGCCTGCATTTTCA
CGTCGCTCACGTACTCGGAGTTCGCATCTCGCGTGCCTGTACGTTGCGTCACAGTCTCTGGATGGCGGTGGATGAGACTCTGATCGTTGTGTGAGTGAAG
GTCACGGGCTCAGCGTACACGTTCGTGTACATTACCTTCGGCGAGCTGGCAGCGTGGCTTATTGGCTGGAATCTGACGCTGGGATACGGCATCTCCGCAG
GTAACCATGGATCGCTGCTGTGGTTGGTGGAACGGGCGACTCATTGTTTGTGTGAATTCAGCTGGAATTGCTCGTAGTTGGGCCTCGTATGCGCACTTGT
TCCTGCAACACTTGGGCCTTAACCTCCCACGTTGGCTCGTGCAGGTGGAGTTTCTTGGCGTGTCGTGCAGCATCCTAGCGGCATTTCTCGTGATTTGCTG
CACGTTCATCCTTCTCGCTGGTGTTCACGTACGTACTCTGAGCGAAGATTTGGTTCCGGTGTGTACGCTGATTAAAGATCGTGCAATTCACAGGAATCTG
CCAAGTTCAATGCGTTCGTGACGTTTCTGAATATCTCGGTGCTGCTCTTCGTCGTGGCGTTCGGAAGCACAGAAGTGGATGCTGCGTACTGGGAGCCGTT
TATGCCTACAGGGATACATGGCGTTATGACGGGTGCTGGTGTGGTCTTTTTCGCGTATTTGGGCTTTGACATGGTGGCTTGTCTTGCTGAGGAGGTGCAT
GAGCCCCAGCGCACGCTGCCCAAAGGAATTATCGGGTCGCTAGTGATCTCGGTAACCATTTACGTGGGAGTTTCGCTCGTCGTGACCGGAATGGCACCTG
TGGATGTACTGGGGAATGAGGTACCTCTTGTAAACGCGTTCATCTTCCACGACGCCCCATGGGCTGGACGTATCGTATCGTTTGGCTCCATTTTCGGTCT
TACTACTGCTGCGTTTACCTGTCTTTTGGGTCAACCGCGTATTTTCTACCAGATGGCCAAGGATGGTTTGCTGCCCTCAGTCTTCGCTAAATTGCACATC
AGGACCCATGTCCCCGTTGCTAGCACAATCTTCACTGGCATCCTGGTTGCCTCCATCGCGTTGGTTTTCGAGCTTGATTTCTTGGCCAATGTGATTTCGT
GCGGAACACTGCAAGTCTTCACCTTCGTCAATGCTGGTGTCCTACTTTTGCGCATGCGTCCGAGTCTCAGTGGCGCTGGTGTCGTCCGCCGCGTTCTGCT
GTACGTGATAGCGTGTTTTGCTCTGTCACTGTCCTTCGTGTTCGATCTCTCGTGGACGGTTCAAGGCGCGTTCGGTATGATGGTGATTGCTTCGTTTGTG
TATATCTACCGACTCGAGAAACTCAGGTGCGCAGCAGTGTCAATGCTTGTACCACAATGATGAACAGCTCTAACATGTTTGCCTCTTCGTTTTTCAGTGA
TCTGACCTCGTCGTTCCAGTGCCCATTGGTGCCGTTCGTCCCATGCGTGGGCATCCTGGCCAACATCTTCATGATGGCAAGCATCCCAGGCGAAGGCTGG
TACGTCTGTGTGGACTCCGAAGTGTTTTTCTTGACGCTAACGTGCAATTTTTTTAAGGATCGGTGTGCTTATCTGGCTGAGCGTGGGGCTGGTCGTGTAC
TTGTGCTACGGGATCCGCCACAGTGTGCTAAACGATATTTCCTTGTTACGCCCACTACTTTAAAGTCATCGTCACAGCATGCCACCAAACCGGCCAGAAC
ATAGAGTATCACGCCTACAATATCATGCGGTTCGTGAGTACGGGGTCGCTCCGCGTGTTCGAGATCAACGGAAAGAAGCAATCAAGGGGGTGAGCATGTC
AGAAGTACCCGGGTTACGGTGGGCTTCCTCGGCTTCGTGCATCTGCAGCTGGTAGATAGACGAAGTGTATGACTGTAATGTACTACAGTAGTAATACAAT
ATAATGCAATCATATTATATTACTCTCTATGACCATAATATAATAATAGTATCTTATATGAAAATCCTTTACCGGCATTTTGTACTTCGAAGTATCTATT
TTGATCACTTACATGGTAGCTGAGCAACATTGAAGACGTGCTCGACACTGTGGACATTGCGTATTGCGTGCAGCGTCAATGCCCTCATCTATTGAATGCC
TCCTACGTTTCCAACTGCCTAGACCCGATGTCGACGACGACGACCGGGTTGATAGTGGCGATGATGTCAGTCTTGACAACCTGTCAGCCAGATCTGGCGA
CGACAAAATGCTGGAGCTCTATCGTCAGGCGGTGCCTCTCGTCCAGCCTCATTCGACGGCTGCAGTCAAAACACTGGGGGCGATTGTACACGACCGCGAG
CTAGTGAAGCGAATGTTGCAGCGCCCGCAGCCGTACGCCAAGCAGCTCGATAGACGACCACTCGCTTACGAAAGCCCTGCATCAAGACCTCCGCCACTTT
CTGCTTTGCCGGTCTCACCTGGGAGTGGACTAGTCATCGGTAACCAAAGCAGCAGCCACCGCCACATGATGTTCATGGCTGCGTGCGAGAAGCTCATGGT
GACTTTCGATCCCCAGGTGCGGCATACTCGACGCGTGAAGCTTGCGCAGATCAAGCCATTGCTGCGCTTTCACGGCTTGGAGGTAGATAACGCAGCTTTT
CGCCGGTGGGAGCAGCGATTGCAGCTTTCAACTGCTTCCGAGCTAGCGACAACGATAGGGCCGGTAGTCTCGGTCAGTGACTTTATTCAAGCGTGCCAGC
TCTGGTTTACCG