Description :
From Genome Similarity Track
Location :
Scaffold_16:70745- 71841
Transcript NameFunction/comments
Physo_131471predicted protein

Sequence
1096 bases(100 bases per row)
AGCAGCGCCGTCGTCGCAAACAGATGCGCACGCTGAATGTTATGAACGAGCATGCAGCGGCGATGACAGAGCACGAGGCCCAACAGCAACGTGAGAAGAA
GATCGCTGTTCTCTTCAAGACTTTCGACACTGATGGTTCCGGTCTTCTGGATGAGAGCGAGTTGTTGCAGCTTACGAAAGCGCTAGGCCACGAGATGGAT
GCAGCACAGGTGAGCCGCATGATGAAGGTCATGGACTCCAGTGGAGACGGCCGCATCAATCTGGAAGAGTTCTTGGCCTTCTGGAAGGCGTTCGAGCATC
GACGCCCTGCAGCGGTAGACGCTGCGATACTGAACCAAACTCGTCGCGATGCTGTGTCCGAGCCAGCAGCAGCGGGAGAAGCAGTGCCGCCGCCGCAGCA
CCTGACTACGAAAGATGCCGTGGCCTCCTTAGCTGTGAGTCTGGAGATGGTCAAGGACAGAGCACTCAAGCTAACGCTCGCTGATCTGAAGGGCTTCCTG
ACCGACTGGAGAGATGACTTGGTGGAGAAACGCATCGAGCAACAGGCAGCGCTGGACGAGGCCGAGGCACTTCAGAAGTGGCGCGAGCTGCACGCGTTCG
TACCGACAAGAAAGCGTGTGTATGGGCCCAAGCGCCTAGACGTGACCTGGATTGAGCCGGAGGTGGTGGACTGTGTCGCAGCCATAATCGCCGATGTAGG
GCTGCGCTTTGACCCACCTTTGAAGCCTGATGCAGCGCAGCGGATCCAGGCACTGGTCAGGGGCCACTTGGCTCGAAAGCGCGTGCATCAGCTCGTCCGT
ACTCGATTCGAGCAGCATATCGATCCGCAGACCCGGCTATTCTACTTCACTGACAACCTCACAGGCCAAGTCCTCCTCACCCGCCCGCTTTACACGACGA
GCACGTCGTCTATTGCTCCTTTGGAGCGTGATGACTGCACCACCAAGGCGGAAAGGTACCAATTTGACAAGCGGTTGGCCGAGCTCCGAGCGAAGAAGCG
CTTCTACGATCAGGTGTGCTTGCCGGCGCTCTCATCCACACGCGGAAGCAACCCTGGCGATGTAACGCGGTCTCACAAGAGCAAAACTGCTTATAA