Description :
From Genome Similarity Track
Location :
contig_24:707448- 724560
Transcript NameFunction/comments
g5517.t1RAW38745.1 hypothetical protein PC110_g5017 [Phytophthora cactorum
g5518.t1hypothetical protein
g5519.t1hypothetical protein
g5520.t1XP_009529817.1 hypothetical protein PHYSODRAFT_346765 [Phytophthora sojae
g5521.t1hypothetical protein
g5522.t1XP_024572550.1 protein-l-isoaspartate o-methyltransferase [Plasmopara halstedii
g5523.t1hypothetical protein
g5524.t1XP_009529821.1 hypothetical protein PHYSODRAFT_354854 [Phytophthora sojae
g5525.t1XP_009529822.1 hypothetical protein PHYSODRAFT_560612 [Phytophthora sojae

Sequence
17112 bases(100 bases per row)
CTGAAACGAGCATGCCAATGGTTAAACTGAGCTGGTGCAACGACGTGATTTCTCCGCGCGAGACGGCGGGCGAGATCTCCGTCAGCAAGATGGGCACCGT
GTTGGTCACGACGCCCGACGCTAGCCCCACGAGCAGCCGGCCGGCGTAGAGCTCACGCTTGGAGGTGGCAAGCGCGCAGACGGCGCTTCCGACAATGTAC
AGTACGTTGTTGACTAGAATGGTCTTCTTCTGGCCCACGCGCGCACCCACCCCGCCTGTGGTAAGCGCCGAGAGCACGCAGCCGACGACCACGAGCGCCG
TGGCGAGCTCCTGCTCCTCCGTGCTGAGGTTGATGTCCACGAGGATGGATCCCACGGCGTCCGGCACGATGCAAACGTTGAGCACCGCGGCGCTGAAGCC
CCACATGAAGGATGAGATGGACACCAGCCACGCCGCGAGCCGCAGTTGACCCGTGCGGCCGCAGCCCACGAGAGACGCCTCGGGACGGACGGGCGCAGCG
CCAGGCTTCGTGGATGCAGCGGAGCGACCGCCACCTACTCGCAGGCGCTGGCGCTGCGGAGATACGGGCGCAATCTTGGGCAGGAGCTTCTCGTGGATGT
CGACGTGGGCCTCCATGAGATGAAGGCGATGGTTCTTCCGACGTTTGCTTCAAGGAGGAAAAGATGCACCACACTGTGTTAACACGAGGTTGTGTGTCCA
CACTAGATTCAGATGGATGCAATCGTTGGGCCAGTCATCAGGCGCGTGTCTTTGCGGAGAGCGAATCCGATGGCGTGCTGGCAGTGCTGTGCAAATGCAG
GGCAAGCCTTTGATGCGCGGGGCGTAGATGCCAACGCTTTTGGGCCAGTGGTGCGTAGCTTTTGGGCCAGCATCTTTTGGTGCTTGTAAAGCACTGTTTC
ATTTACATTTTGTGTATTACATTGAAATGGGCCTATTATTGTCTGTTCCAGGACGACGCGACAGCGTGTTTCGACCGCATAGATGCGCGACAATTTTACA
GTACAACTTCAACAATTACCGCGAAAAGCTCATGTTCGCATAAACCTACCAGGCAAGCTCGTCTTAACATTGAAAAGTCTTTGGAGCGGTAGTTATGTGT
CATCCCGGGCCGTGATTCACGGCTCGCTCCGCCCCACCACCGTCGGAGCACTGCCGACTGTATTGCTGCCGGCGATGCGAGCATACCGGCGGGCGAACTT
GCCAAAGAAGCTTCGGCTTTAATAAATCGACGTCTGCTTTTCATTGCGACTGCAGCCGTCTAACGACATCCGTCGCGTCGAGACGGCAGCACCGTGTCGT
CATCGCCGGTTTACCAGTGTAGCAAGCGTGCATTTCCCGGGATCCAGTCCATGCAAGCCTGAACAGCGCGTAGCGCAATGGCACAGAGCGCGTTAACTTA
TGGCTGGCGGCAGTCTCTATCTGGCATCTTTACATGGAGTAGCAGTGCTGCTTGGGGGGCCCAAGTAACGTAGCAAGTTGAGGCAGCACCGACAAAGCCA
CAATAGTTGCCAGCATTAATGCCAGCACTATTGCCGGCACTAATAACAGCGCTGAAACGCCAGCAGCATGGTCCAACGGCGTTAGGCTTACGGCGTTAGG
CTTATGGCGTTGGGCTATTCTGGACTCGGCCTGGGACCGCGGGCACGGATGAGTGACCATGCCTTCCATGCCGAGCTCGCAAGCACTGCAGCCGCGGGCG
ATAATCATCCAGATAGGGTGAACGAATTGGCCGGTCGACGCCGTGCCCTGCAGCGCGCCAATTGCAATCAAATCGTCGACAAAATTGCCTTCGGCGAGAT
CCACAGCTGCCTCTGAAGAGGTGCATGCGCTGTTGCGGTTTCTATGCGTTGGACCTGTCTCCGCTTACAAAAATCAAGTCAAAACCGCCCAGGTCGGGCC
CTAGTCCCTGCCCATCTTGCTGACTCTCTCGCTGCGATTCGCGCAAAAGCGGTCGAGGTCTGCTTTTCGTCCAATCGGCGCGCGGCACGACCGTCGGCAG
GAGCCCCAACCCGTTTTACCCTTCTCGCTCCAGCAAGCAAAGGTCCACGGAAGAAAAGCCGATAGGGAGCCGCGAGCCCGCTAGAACGCAAAGTGCTCGA
AACAAGAGAGAGCAGAACAGGAAAAACAGGAAACAACCACCACCATTGACTCCCAAGGAGCACGAGAATGTGCCGGCCGATAGAGTCCCGCGATTCGCTG
GGCGCCATGGGCCCGGCCGCCGTCGCGCTCTTCGCTGGCTACCAGCCCTCCGCCGCCGTCGCGGCGACAAACAACAAGGCCATGCTGAGCCAGAACGTCA
AGGCCTCGGGCCGCGCGCCCGCCTGGTCCACCGCCGGAGACTTGGGTTTCGGCGCGGACGGCATGAACATGCTAAGCATGGCGGCGCCGCCCCCGGCGCT
TCCCTTCGTGTCCTTCCCGAAGCCCAACAGCCTGCCGGCCATGCCGTGGGCCGCCGCCGCCCCTTCGACCGACCTGCTAAGCCTGGGCCTGCCCAGCGAC
CAGTTCGCGGCCGCCGAGACCAAGCCTGAGGCCGTGCAGCCCAACTTTGAGGCCCAGGAGCTCGAGGAGCTGCTGGACTTCTCGATGCCCGGCGAGATGG
AGAGCGTGAGTAAGGACAAGCCCGACCTCGTGAACCTGGACGATGGCTTCGACGGCACGGAGATGTCGATCCTGTACAGCTTCCTGGTGGACGCGCCCGA
GGACAAGGCCAAGCAGACGGCCGAGATCGACGACGGTATCCTGAACCTGAACGTGCTGGCGGGATCCCCCATCGACGGCCTTATGGAGTCGTTCGAGAGC
GACTTCACGGACTCGGAGCTCATGATGACACCGCGTCAGCCGGAGCCCCACATGGTCGGCCCCAAGACGCTCAAGCCCGGCGAGGTCAAGAGCCGTCGCC
TCTGTAAGAGCGAGGGCTGCTACAAGCGCTCGCGCTCGAACGGCCTGTGTATCTCGCACGGAGGCGGCCGTCGTTGCGCCGTTGAGGGCTGTGACAAGAG
CTCGCAGGGCGGCAACCTGTGCATCCGCCACGGCGGCGGCAAGCGCTGCAGCCACGAGGGGTGCGACAAGGCCGCGCAGTCGAACTTCCTGTGCAAGGCC
CACGGTGGCGGCCCGCGCTGCCAGTTCGCTGGATGCTCTCGCAGCTCGCAGGGCGGTGGCTTCTGCCGTTCGCACGGTGGCGGCAAGCGCTGCATGTTCG
ACGGCTGTGACAAGGGTACGCAGCGCGGCGACTACTGCGCTCTCCACGGCGGCTCGCGCCTGTGCGAGGTGCCAGGCTGCATGCGTAACGACCGCGGTGG
GGGCCTCTGTGCCACCCACGGTGGCGGCAAGCGCTGCACCATGGAGGCCTGCAACAAGCCGTGCCGACGCAAAGGCCTGTGCTCCGCACACCTGCGCCAG
GTGGAGGGTACCAAGTAAAGGACGGGTTGATCGAGTGGAAGTCGCTCCGCCCTTGCCGAAGTGAAAGACGAGGAGAGGACGACGGTGATGGTGGGACGAC
GACACGGGACAAAGAAGGAAACGAGGAGGGGAAGGGAGCGTGGGAAGGAGGAACTGAGGGTGGAAGGGAAACTGACGGGTCTAGTGGCGTTGGAATCCTT
TGCTGCCACTTGGTCGGTCGAAGTCGAGCAGCGGCTTCAGTCTCTTTGCGATGGAGAGTGACTTCGGCCGACGGCAGCAGGGGAGGCTCTGCATTATTCA
TATGGTGTATAATTGGCTTGGCGGATGCGTGCGAGCGTGGTCCGTTGCGACGAAGGAAGGTCAAGAGTCATCGAGTGGTGGCGGAGTCGAGTGGCTGTCC
CGACCAGTTTTTCCAGGAACTGAAGGGGGTTGAAGGCTGGCGAGACCGAAGCTGAAGGTGAGTCGGCTCAGCAAGGGATGGTCGTTGGGGCCCCATTCGA
GCGGTGCTTTGGTTCTGAAGCGTTGGCGGTGCGCATGCTGCTTGCAGTCCGTCAGCTCTTCTTTATTTACAGCGAGGAAATGTTGGAGTAATGCCATTTT
GACCTTTTAATAGCGTGGTGTTCAAGTCTCATATATAGTAGCAATTCTTTAGTGCATGCGTTCTTATGTGTACTCGGCTGACTCATCTACGAGCGCTGGG
CTGCACTCGACACTTGTCGAGTCGAGTTGGCGGGCGCAAATAGATGCCCGCACCGTCGGTATCGAGTGCAACCGCCAAGCGCACAGCTCCAAGCAGCGAT
ACTGTTCTTTTCGAGACAAGATCTACACGACGACAAGAGCGGCGGAAACGCGACCGTTCAGATTGCCTTTGCCCAGCAGCGCCTGACCAGCGACGTGGGT
GCGGATTCAGTGCGGTGGCCCATGTAGCGTGGCGTCAGCGACGCCCAGCTCAACGAGCGAGTCGCTGAGCTGGGTGAGGACAGCCCCTGGCCTACATCGC
GCTATGTTGCCACTGGCCATTACGATCACCTCGGGCGCCGATAGAGCTTCGAGCGTCATGAGCGAAAGCACTGTTCTCCGGTTGAAGTTTGTTCGTGGTC
TCATTTGTTTGTGGTCCCAATATAATAGAAAAAATAATGGAAACATAAAAACAATTAATATACCAAATACGCATATAGACAATATTGCTACTTTGGCGTC
GTCCACAAGGCCAAGCAATACAGGTATGGCGGGACCCGATGCGGACGATGCGATGCCTCGCGCCAAGCGGCTGAAGCTGTTGCGCGAGGCCAAGATCCGC
AAGGAGCGTGGCGAGAGCAGCAGTGGCGAAGCTGGCGCACTGGTGGTTGCAGGGGTGAAGCCCGTTGAGGACGAACCAACGCAGCCGAAGGACCAGGAGG
ACACCGATATGCCCGACGCGGACCAAGCTCCTGACAAGACAGAGGACCTCGTGGAGAAAGTGGCTCTGGCGCAGGAGGAGGACGCCAAGACAGAAGACGA
GAGTGAGGACGAGCTGCTGAATTTGGCGCCCAAGCGCGCCAACTGGGACATGGAGCGCGACATCGCACCCATGCTGCGCAAGCTCGAGAAGCGCACGCAG
CACGCAATCGTCGAGATCTTGCGTACGTTTGGAGCTCAGCTTGGCACGTTGTTTTGAATGCTCATGTGTCTAACAATGGCTCTGCTGGAATTGCAGGTGA
GAAGCTGGCAGCAGAGCAGCAGGAGGAAGACGACGATGACGAGGAAGAAGAAGAAGAGGAAGACGAGGAGGTGGAATAGCGCCGTCATTTGCAGTGCAAT
CCTATGTACTATGATATAGCGCTTCAGTGCACCGTCTGGGACCAGCAGGGTTTAACCTGGTCACCTAGGTGTTCATTTAATGTCTTCGCTTTTAGCCTTC
TGCTTTTTAAGCTTCTTCTTGTCATCCTTGGATCCGTTTTTGCGCTTCTTGTCCTTCTTTTTGCCGTCCCCCTTCTTCTTCTTTTCTTTCTTCTCGTCAT
CCTTGTGGAACTGCTTCAGCTTCTTGTATATCTGTTTGACCTGCTTGCCGCGATGCTGCACGGCTTGCTCGCCGCCCTTGTCTTTTTCTGCTTTCAGTGC
TTGGAATGCCTGCTTAATCTGCTGAAATCGACCCGTTACCTCGTCGACCGGCTGGTCCTTAGAGAACTTGCTGCGTTTCATGTAGTCCAGTACATCAGCA
CTAGTGAGTCCGCACGCCTTTTCACCGCTGCTAGCAGCAACCTCATCCGTGACATGCCATAGCGCTGCAAGCGCCAAAACCGACGGGTAGTGCAGCAATG
GCAGGTCTGTGAGCAGCATGTCATTGAGCAGTGCGGTCGAATTGGCGTGCAGCTTTTGCAGGACGGTCGCAGGTAGATCCTTCGACAACACCTGCTTGGC
GAAGGCGCGGAAGTCGTCCAAGAAGCCCAGCAGCGCACGGAACGGGTGATACATGATGAGCTGGAAGCGCACGCCCTCAAGCAAGATCATCTCGTGGCCA
ATGATGAACTTGTGGTCCACGTGGAGCTGGTCAGCAACGGTGTCCACGGACATGTACTGCTCCTCGACCTTTCCCGCCACGTAGATGGCCGTAGGGACGA
GAAACTTGGGGTGGAACTCCATCACACTGTTGCTTAGATAGAACCTCTTGAATAACAGCATGGCGCAGCACTTGACCTTGTCTGAAGTGCGCAGGAACTG
GGCGCTGCAGCTCTCCTGGATCTTCTCCTCGTAGAAAGCTCGGAGCAGCGCCTCCTGTTCCGGATTCAGGAACTCCAACAGCGGCGTCAGTTGCAGATTG
GCCTTCTCCTCCGCCTCCTCCTCTGTACTCAGATCCATGTTCACCTCGTCGTTCCAGTCGAAGGCGTCGCGCACTGCAGTGGACGAGCGCGGTATTAGAG
CCGAAAAAGACCGCGCTTTGCGGCTACTGGCGGCCGCCGCCTCAACCTTCTGCGTTTCCCCGCGCTCTAGACGCAGCGCGCGCTTCGTCTTCACATGCTG
CAGACGACGCACACGCGCCAGCTCCTCCGCCGAGAAGACCCAGTTGTTGAAATGCGTCGACGTCGAGAGGTACGACATGCTGCCGATCTGCCGCAATTGG
AGTGCTGCGGATGATATGACACTACATGGGGTATGCTATATTAAAGGTGAGTGTGTACCACACCATATTGAAGTTGGGTGACGTCGAGCGCATCGATGAT
CTTCTCACCACTTGAGTTTTGGCCATGTGGGGCGCTCGTTTCGCGCTTCGCCAGCCTCTCGGGGCCAGGAGCTGCTCGTCACCGCGTGTAATGACGGCGA
GGAAGGTGGCGCTGCAGCAGCTGCCGCTCGTGGACGTATCTCCGCTGGTTGCGGCTGCCAACAGCGGCGGCGAGGTGCCACCCGAGACGAAGGCGCAGAT
TTTGAGCGACATGCGCTCAGCATGCATCGACACGGGCTTCTTCACGGTCCCCACAAAGGGAGTGCTGTCCAGTCGGCTCGTCCAGGCGGCATACAGTCGA
GCTGACGAGTTTATCGCGTTGCCGGACTCGGTCAAGCACAAGTATCACTGCAAGCGCTCGCCCAATGCTCGAGGCTGGACGCCCATGTTCGAGGAAGCCA
TCGGTGCGATAGAATTGATATTGCTATGGCAGAAAGGATAGGGTGTTGATGGCCTGGTTTATGCTGCAGTACCAACCGGATGTGGTGTCCCACTTGGAAG
GCTTCGATCTCGCCAGAGAGCTCCCCAAGACGTACGTGAAGGAGGGATCGAGCTTGGGTCCTAATGTCTGGCCAGCTGAAGTGCCACAGTTTCGGGAGGA
CGTGTACACACTGTATGAGGAGACTACCAAGCTTGCGACGGTGCTGTTTCGGAGCTTTGCCGAGATGTTCGGCCTTCCATCGTCCACGTTCCTGGTGCGA
CAGTGATTTCATATACTAAAGCTGGCGATAGACGGTAGTGACTTTCTTGATGCTGTAGCAACACGTCGATGAAGAAGCTGAAGCTTTCATGCGGCTGCTC
ACGTATCCAGAGATCGAGGCGCCTGCGAAGAACTCGACGGTTGGGATCGCCTCACACACCGACTTCGAGTGTTTCACTATCATTCACCAGAACGGTGAAG
GACTGCACTTGCTGAACCGCCAAGGCGTTTGGGTCGAAGCACCTGTGTGCGATGACAGGTACCAAAAGACTTGGCTCACGAACCTGTCGTTGGACTAACT
TGCCCTGTTTTTTTCTACTCCCAGACTCTTTATCATGGTTGGCGATATGCTCGAACACTGGACTAATGGCGCCCTAGTTGCTACAGAGGTAAGCTCCGCA
GAAACGACGAGTCAATGCTTTGTTTTGATCTACATATATCTTGTCTGCAGCATCGCGTGTGCAACTCGGAAAAGAAGCGCCAATCCATCGTGCGCTTCAA
CGGCGCGAACGGTGACACGGTCGTGGAGCCACTTCCGGCCTTCGTGACACCAGAAAATCCGCCTCGCTACGCGAGAATGACGCAGCGCGAACACATTACC
CACCAGATCGAACTGGCGGAGCAACTTCTGCAGAAAACCAAGGCCGCGGCGCATGCCTGATGACACAGGTCAGCAAACCTCACACACGATGAAAATGGCG
TCGTCAATAGCCGATAACCGTGACATTGACAGCTTGATCCCAGTAATCTTTCCTCTACTTTCGCAGCGCTGCGAACTCTTGGAACAGCTTTTTCGACTCA
GCATTGCTCATAAGATCATCTCGCGTGGGCTTCCGTCCGTTCTTAGCTTCAAAATCCTCACGCCACTGGGTAAGGGCCTTCTCCACGCGCGTGAGTTTCT
CGGTGCGCGTCTCCTGTACAACCTCCACGGGCACAGTGTCGAGTATAGGCTGGCAGAGAACGCTCATGATATCGCGCTTGTCTACAGTTCCATCAGCATG
CTTGGTCATCTAAAACCACAACGTACACGAATTTATGAGCTCAGTGCAATCCCTTCCTCGTCGCTCCTCTTTACGACTCTCACCTTGACCAGCTTCTGCT
CTGCACCCGCCCCACCAAGTGGGATCAAGAGTCCACCTCCAGGCTTCAGGTACTCCAGAAAGCTCTCGGCTTCAGCCTTGGTTTCTACGGCAACACCGAC
ATGGATGCAGTCATATCGACCATGCGATGGGAGGCCGAGGTCTCTCTTGCCTGTACTCAGTAAGATCTCTGTCTGCTTCTCCGCGTCCTCTTTACCCAAA
CTGCGCTGCAAATTCTGTTTCGAGAACTCCACGAGCTCCGGCACAATATCAACGCCCGTGACAAAGCCCATAGGCCCCACCAAGTGAGCCATAGCAGCCA
CAAGGATGCCTGACCCGCAGCCCACGTCCACCGCAGTCATCCCTGACCGCAGGTGCTTCTCCAACAGCCCCAGCACCTGCGCGTGCTGCTGCGGGGTGGA
AATCGTCGCTACCGAGCCGATTTTCAACGGGCGATTAGCATAGCGATCGCTCGAGGCTCGAAACGCGGGTGCCACGAAGTCCCCACGGTCCACGCGCCTC
AACGCCGCCTCCAGTCGCGAGCCAGAAGCCACCACATTCGTCCGGACCAAACTATCCACCAGCGCAGCGTGCGAGTCGCCACCGATTTGATGGCCGATGC
TGGTGCTCACAAGCAGGTCCTCCGAGATGCCACTTAAGACGCTCAAGGGCGGGAGGCGCCTGCACGAGACGAGCGCCACGGCCGGAGCAGCGACGACATT
CCTGATCAAAATCTGAGGTGCTGAGAATATAGTCCAGGAATTTGTAAAAAATAGTCTTCAAATTAATAACAGCTCAAATTCATGGTTATAGTTTTGGGCT
CTACACGATTGGAACGGCCCAAGCTCCGTGGCTCTCGATGTTGTAAATGTTAACGCCTCTCGGCGAGGAAGAAGCCGCGGTCGCCCCAGTTTGTGCCGTC
CGAATTGCGGACGACCCAGTACTTGACACCAGTCTTGGCGTCGGTGCCCCACCCGACAAGACTCACGACATGGGTCGTGCCTGGGTATTTCGTCGAGTCA
CGCAAGATGTAGCCTCCTTTGAACTGACGGTACTCAGGTGATAGCGAGTACATGCTCACAACAATCGGGCCACGATGGTAGATCTCGTTCATGGCCTGCA
GTTGGAACTCCTCGGACGTCGTGAAGTTGAGCGTGCCGTACTCTGAGATGCGGTACTTTACCGGGTCTTCGAGCACGAAACACTCACCCTTCAGGTTGCA
CGTGTGGCACTGTGTGGCAGCACAGTCGCCGCCGCCCATCCAGGACGGGTGCGACGCAATGTATGGGTTACACGTCAAGTCCACGATACCATTCTCGTGG
ATCCACTTGTGTGCATGCCGCGGGTCTCCACCGTGGCAAGAACCAAAGGATCGCATGCCACAGTCCAGTAGCACCTGAGGCGACAGTAACACCTCGGTGT
CGAGTCGCCCGGTCTTCTTGAACCGCGCGATGCGGATACGGTCCGACAACGCGCTGACTGTGGCGAAAGCCCAGCACGACCCGCACGCACGGGGCACCAT
TTGGTTCATGATGCTGGTGGTGAGGCTGATACCGGTGCCGTTGTAGTCCCGCCAGTCCCAGTTCTCGGGCAAGTCGTCAAAGGAGCGAACTTCCTGCAAC
GGTGTCAAAACGTGTTCGGGGTCGTTGCCGCCAAGGAACCAACCGGCTCCTTTGTTCGTTTGGACCGTCGCAACGCCACCCTCGCCGGTTTCAGTGCCAG
CGGCAGCACACGCCGCCATCAGATCGAGCTGGTCTTGCACGGCGTGCATCGCGACCCCGTCGTGCGTGTAGTCGGCGAGTTGCTTGGGTGCGAGCACCGC
CGAGTTGACGAAGCATCCCAGCACGATCCAGCCGAGCACTGAGCCAATGGAGCGCAGTCGGAAGCGGTCAGCTCGGAAGTTCTCCCAGCTTGACTGCAAC
AGCGACGACGTTGAAGTCTCAGGACCGTTGCTGGGGCTGAGGAGCGTGCTGGTGCGTGGCTGCAACAGCGGCAAGTCGGACTTGTCGGTGATCGCCATGG
GGCTGCTGGAATTGGTCTGGAGACTGCGGGAGAAAGTTGCAAAGTGAGCCGCGTAGGGCTGCAGAGGGTGAGCCATGTTCTTCCAAGTCTGACGAGGAGC
TCTTCTCGTCTGTTGGAAGGACATCATCTGCTCTGTTGGCGACGCGACTCCATGTGATTGGCCGAGCGAAGCGGCGTGGACCAATCAGTGGAAAAAGAAC
TTGATCTTGAAGTAACGGCTCGCTAGGATGGATACACAGGGGTGATCGGTGCGGGAGGGACAACGCCCAAATCTTAAAGCTGGTGATGGTGCAAATATGA
TGCAATGGTCAGGCATGCAGTCAGGCACTCGAGTTGTTGGCGGCGCCGTCCCCGCCCGCGTCCCAAGCAGCCATTGCGACGGGCGTCCAATGGTCAAGAG
CTCCAGGCTCCAGTCACGCACGCTACGGAGTTGATGCTGACACTGCCGTCGACGCAATCTGCCGCGTTAGGTGTGGGTCAGGTCGGCGAGGAATTTCGTG
TCAGGGTCCCCGCTGTCTGCGGTGTCACGATTATGGACGTCTTGGAAGGATGCTGTGCCGCACAGTCATGCTGCAGAGAATAGGCACGAGTGCCTGACCA
AGGCAAGAAAATCTTGCTCGCTGGGCGATAGAGTTTGTACCCGAGTGATGGTATGGTGTTTGGTGTTGAATGTACACAGTCGCTGCGCTGCGAATCAAGT
GGAGATGATGTTTTCTAGTACTTTTTAATCGTCTCCTCGCTGAAGTTTCCCACTGTCGACAATGGTACAAGGCACGCAAGGCCGTTCCTGGCGAGTTTCC
AGACTCCCGATTGTCATGATCGTGCGCCATCCGCTTACAACTCGGCCAAATGCCACTGCAGGTCATCAAAAGCGAACAGTGTACACGTTAGTTTCAGGAT
CGGTGAACTTGGCAAGAAAGACAATAACTTGCAGTACCCTTACGGCGATCGAGCCACGGTTGAGGCGAGAGGGTGATGAAGAATTGGGAGCCGTTCGTAT
GTGGGCCTGTATTTGCCATTGACTGCAAAGAAACTCGTTAGACCATTTGTGACTGATGGACGAAGGTTAGTTTGTAGGTACGGACGTACAAGGATGCCAG
CAGCGCTATGCGAGATAGCGAAGCTCTCATCACCAAACTCGAGGCCGTAAAGAGACCGAGGAGGCCCGTCTCCTCGACCATTACCAGCCACATCACCAGC
TTGGATCCAGCCGCCACGTACAACGCGGTGCACCGGGTTGTCCTGGAAGCCTAACTGTTGTGTTTCATCGTTGATGTCAGGGACCTTGTGCTCACAGAAC
GCCAGAAAGTTTTTACATGTTTTGGGGCACACGTCCTGGTAGAGCTCAAGTTCTACCCGCGGCAGCGCCACACCATCAACTTCGAAGACCAGAAAAGCAT
ACTGATGTCCAGACGACTCGCGATAATGAGCCAGAGCTTGTTGGGCTGCTTCCTCCGCTTTTGCCTCCAGCGTTTCTTCCGCGAGTGCCAATTTCTCGTT
ATACTCTTTCCGTGCGCTGTCACTGCCATCGCTATCATTGCCGAGCACGGGCATCCCATCAAACGCTGCAGCGGCTAGCAATTCATTCCTCGAGAGTTGT
GTCCGTTCCATTGCGAAGTCGAGCAAGTCGTCTTCGCCGTCTAGCATGTCGTTTGAGGAATCCAACAACAGTATGATTGGTCGAGTCGTTCGAAGCAGCT
CTGCACGCCCGCTCTTGGGGATTTTCTCCTGCTGGTTTTGCAAATACTCCAGGTATTCAATCTCCATCATCCCTTCCAGCGGAGACACGAAGATTGGGTG
CAGCTTCCGCAGCTCATGGAGCAGCAATCTACAACGCTGGTAAGCCACGTCACCCATGAGACCCACCAGCTCGCAGCACTCCATTACAGCCCCGCCTGTC
GTCGCCATGTTAAGACACTACTTTGTCTGCTTCAAACTAGCACAAATGCCAACTGCAGTCCGTTTGCGTCGCGTCCCCGCAGGTTTATTTGCGGCACAAA
TGGGATGAGCCTGAACATACACAACCACCCCAAACAAGCACAGCATCAACTTCAAGATACAACCCACCATGCGGTGTTCATTTCCGATTGTCTCGTATCT
GCTCTACTCGGCCACTCGACTCGAATAAGATAGTTCGAAAACGCGCACATCGGCGCCAGATGAGAATGCCCACAGCACGTAACAGCGCTCCGATTTAAAC
CTTGCTGTAGTCCATCTTGGACTCGAGCTTCTTGGTCTCAGCCAGTTTCCGCGCAGCCTTCATGAAGTCCTCCTCCACAACGTACTCGCGATCAGCGCGG
ATAGCGAACATACCCGCCTCCGTACACACGTTGCGCATATCGGCACCGTTGAAGCCATCTGTGAGCTTGACAATAGACTCGTAGTCAATCTCGCCCTTCT
TCGTAATGGGGCCAGAGTGAATTTTGAGAATATCCATGCGCGAGGCCTCGTTAGGCAGCGGGATCTCGATCTTTCGGTCAAGACGACCAGGACGCAGCAG
TGCCGGATCCAGAATATCCGGTCGGTTCGTAGCCATGACCATCTTCACTTGTCCTAGAGCGTCGAATCCATCCAGCTGGTTCAGCAGCTCCATCAGCGTA
CGCTGAATTTCACGATCCGCCGATGTGCCTTCCGAGTAACGACTTCCACCGATAGCGTCGATCTCATCCATGAAGATGACACACGGCTGGTGGTCTCGGG
CGTACCCGAACATCTCACGAATCACACGGGCGCTTTCACCGATGTACTTGTCCACAATAGCACTAGCCACGACCTTCAAGAAGGTGGCGTTAATGTTGCA
CGCGAGTGCACGCGCCAGCAGCGTCTTGCCCGTACCCGGCGGGCCGTACAATAGCACACCCTTGGGCGGCTTGATACCAACCCGCAGGAAGAGCTCCGGG
TTGGTGAGCGGCAGCTCGATGACCTCACGAAGCTCGCGGATCTGCTCGTTCAGTCCACCGATGCTCGAGAACGACACGTTGCCCGCGTCCTCATTCAGCA
TGTGGTACACTGTGGGGTCCACCTCACGCGGCAAGTAGCGCATAATGGTGAGCGTCGTCATGTCCAGCGCCACGCGCGTACCCGACTTGAGTTTGCTCTT
CTCCACCTTGGCGCGGCATCCCACGACGTAGCGCGGGCCGCTCGACGCCTTGACAATGAAACGGTCCTCGTCTAGCTGCCGCAGCACTTCACCAATGATT
TGGCCCACACTCTGTAGAGATAAAACGTCGTCAGTTAAGGAGATAACAACGTTTTAATAGAGTAAGACTGCACCTGCAGAGCCTTGAGGTCATCCTCCGT
CTTGTTGAACTCCTTCACGAGCGTCTTGACGTTCTCGCGCATGTTCTTTACCCTGTTTTACATGGGGAAATGTCGGTAAATCGTGAGTAAATAGCAGAAG
AAATTCCAGCAAATGAAGCGAAAGATCGCAAGCGACTGAACGAAGGACATAGAGCGCTATAGAGAGACATGTTTGCATGCAAAGAGAGCCACACACCTGC
TCTCCATCTCGCGGTGCTCCATGACCTTGGCCTTGTACGCGTTGAGCACCTGCGTGCGCTCATCTTCGGTCGGCACGGACGCCATCTTCGCCTCACTGCT
TCGAATCGAGTTCTCCCCTTTTTGGATACGGCACTGAAAATCACCCAATCAAAATCGCATAGATATCTAATTGGCTGAAAATACGCCTGCGTCAAGGGGC
ACATCTTGTCCAGCTAGCGTAACCGCCCATTGATACACTCGCCGCGCGAGACTACAGGTAACAACTCAGACATCCAGCAATCAAGAAGTCGAGCGCCATG
GATCGATTCCTGCTGGCTGCTGGCCGCGTGAAGCCTCTGTCGCGCTGCGAGATCGGTGCAGGATCCTTGAAGAAGTGCCTGACGCTGGTGGATCTCGTAG
CTTATGGCGTGGGCTGCTCTGTGGGCGCTGGCGTCTACTCGCTCGTGGGTGTCGGCGCTCAGATCGCGGGGCCGAGTATATCGCTGTCGTTCCTGATCAG
CGGCCTCGCCTGCATTTTCACGTCGCTCACGTACTCGGAGTTCGCATCTCGCGTGCCTGTACGTTGCGTCACAGTCTCTGGATGGCGGTGGATGAGACTC
TGATCGTTGTGTGGGTGAAGGTCACGGGCTCAGCGTACACGTTCGTGTACATTACCTTCGGCGAGCTGGCAGCGTGGCTTATTGGCTGGAATCTGACGCT
GGGATACGGCATCTCCGCAGGTAACCATGGATCGCTGCTGTGGTTGGTGGAACGGGCGACTCATTGTTTGTGTGAATTCAGCTGGAATTGCTCGTAGTTG
GGCCTCGTATGCGCACTTGTTCCTGCAACACTTGGGCCTTAACCTCCCACGTTGGCTCGTGCAGGTGGAGTTTCTTGGCGTGTCGTGCAGCATCCTAGCG
GCATTTCTCGTGATTTGCTGCACGTTCATCCTTCTCGCTGGTGTTCACGTACGTACTCTGAGCGAAGATTTGGTTCCGGTGTGTACGCTGATTAAAGATC
GTGCAATTCACAGGAATCTGCCAAGTTCAATGCGTTCGTGACGTTTCTGAATATCTCGGTGCTGCTCTTCGTCGTGGCGTTCGGAAGCACAGAAGTGGAT
GCTGCGTACTGGGAGCCGTTTATGCCTACAGGGATACATGGCGTTATGACGGGTGCTGGTGTGGTCTTTTTCGCGTATTTGGGCTTTGACATGGTGGCTT
GTCTTGCTGAGGAGGTGCATGAGCCCCAGCGCACGCTGCCCAAAGGAATTATCGGGTCGCTAGTGATCTCGGTAACCATTTACGTGGGAGTTTCGCTCGT
CGTGACCGGAATGGCACCTGTGGATGTACTGGGGAATGAGGTACCTCTTGTAAACGCGTTCATCTTCCACGACGCCCCATGGGCTGGACGTATCGTATCG
TTTGGCTCCATTTTCGGGCTTACGACTGCTGCGTTTACCTGTCTTTTGGGTCAACCGCGTATTTTCTACCAGATGGCCAAGGATGGTTTGCTGCCCTCAG
TCTTCGCTAAATTGCACATCAGGACCCATGTCCCCGTTGCTAGCACAATCTTCACTGGCATCCTGGTTGCCTCCATCGCGTTGGTTTTCGAGCTTGATTT
CTTGGCCAATGTGATTTCGTGCGGAACACTGCAAGTCTTCACCTTCGTCAATGCTGGTGTCCTACTTTTGCGCATGCGTCCGAGTCTCAGTGGCGCTGGT
GTCGTCCGCCGCGTTCTGCTGTACGTGATAGCGTGTTTTGCTCTGTCACTGTCCTTCGTGTTCGATCTCTCGTGGACGGTTCAAGGCGCGTTCGGTATGA
TGGTGATTGCTTCGTTTGTGTATATCTACCGACTCGAGAAACTCAGGTGCGCAGCAGTGTCAATGCTTGTACCACAATGATGAACAGCTCTAACATGTTT
GCCTCTTCGTTTTTCAGTGATCTGACCTCGTCATTCCAGTGCCCATTGGTGCCGTTCGTCCCATGCGTGGGCATCCTGGCCAACATCTTCATGATGGCAA
GCATCCCAGGCGAAGGCTGGTACGTCTGTGTGGACTCCGAAGTGTTTTTCTTGACGCTAACGTGCATTTTTTTTAAGGATCGGTGTGCTTATCTGGCTGA
GCGTGGGGCTGGTCGTGTACTTGTGCTACGGGATCCGCCACAGTGTGCTAAACGATATTTCCTTGTTACGCCCACTACTTTAAAGTCATCGTCACAGCAT
GCCACCAAACAGGCCAGAACATAGAGTATCACGCCTACAATATCATGCGGTTCGTGAGTACGGGGTCGCTCCGCGTGTTCGAGATCAACGGAAAGAAGCA
ATCAAGGGGGTGAGCATGTCAGAAGTACCCGGGTTACGGTGGGCTTCCTCGGCTTCGTGCATCTGCAGCTGGTAGATAGACGAAGTGTATGACTGTAATG
TACTACAGTAGTAATACAATATAATGCAATCGTATTATATTACTCTCTATGACCATAATATAATAATAGTATCTTATATGAAAATCCTTTACCGGTATTT
TGTACTTCGAAGTATCTATTTTGATCACTTACCTGGTAGCTGAGCAACATTGAAGACGTGCTCGACACTGTGGACATTGCGTATTGCGTGCAGCATCAAT
GCCCTCATCTATTGAATGCCTCCTACGTTTCCAACTGCCTAGACCCGATGTCGACGACGACGACCGGGTTGATAGTGGCGATGATGTCAGTCTTGACAAC
CTGTCAGCCAGATCTGGCGACGACAAAATGCTGGAGCTCTATCGTCAGGCGGTGCCTCTCGTCCAGCCTCATTCGACGGCTGTAGTCAAAACGCTGGGGG
CGATTGTACACGACCGCGAGCTAGTGAAGCGAATGTTGCAGCGCCCGCAGCCGTACGCCAAGCAGCTCGATAGACGACCACTCGCTTACGAAAGCCCTGC
ATCAAGACCTCCGCCACTTTCTGCTTTGCCGGTCTCACCTGGGAGTGGACTAGTCATCGGTAACCAAAGCAGCAGCCACCGCCACATGATGTTCATGGCT
GCGTGCGAGAAGCTCATGGTGACTTTCGATCCCCAAGTGCGGCATACTCGACGCGTGAAGCTTGCGCAGATCAAGCCATTGTTGCGCTTTCACGGCCTGG
AGGTAGATAACGCAGCTTTTCGCCGGTGGGAGCAGCGATTGCAGCCTTCAACTGCTTCCGAGCTAGCGACAACGATAGGGCCGGCAGTCTCGGTCAGTGA
CTTTATTCAAGC