Description :
From Genome Similarity Track
Location :
Scaffold_137:7070- 11153
Transcript NameFunction/comments
Phyin_T30-4PITG_20020Putative uncharacterized protein

Sequence
4083 bases(100 bases per row)
TTGAAGAGAAGGATGGTCAGCAGGACCCTCGGCCGATGCCACACCGCGACCGGGCTCAAACGACGCCATAATGTGGACAGGTCGAAGTCTTTCCGGGAGC
TCGGGCGAATCTCAGGAGCGGCTGGTGTAGGAGGTTGTACAACTGGTGGAGGGAGCTGCACGATCGGAGCAGTATTCCCTGCTGACTTCTCGCCCTCTTA
GGCTTAGGAGTCGCCGCCTTGTCCTCCAGGCCGTGGTCGGACCCGTCTTCAGTGGCGTCGTCACTCTTCGCTCGACTGGTAGTAGCTGCAGGCGACGTGG
TCGTGCGCTTGGGCGCCTTCTTCTTTCCCTTGCGGGCCTCGGCCGGCGCTGGAGAGGAAACGTTGCGGGCGGCAGCTCGCTTGCTCGTGCGAATCGGCGG
AGGGTCCGAGGTGCTGCGGGCGGATGTATTGGTCCACGTCTCCTCTCCACCAGTGACGTCGACGACGTCGGCTGCTGGGACGGTAGAGGCGCTGTCGGAC
GGGGCCGTGGTGGCCCTGGACGATGGCGAGTTGGGTGCGCTGGAAGACATGGTGTAGGATGACCCCCCCCCCCTCTTTCTTGGTCGTAGTTCTTGTTCTC
CAAATGCGAAGTGAGGAGTGGAGGCCATGTGTGTGGTTGGCAGCTTTCAAGAAGTACACGTACCGGTACTACGCCGGATATACCGGTCACAGATAATCTC
GTGTGGAAAACACAATTCCCTTCCTCCGCTCCGCCCCACTACGGAATACACCGTGTTCAACACACATGTTGCTACTAACAGCAGAAGTGATGTTCGTATA
GTAATTTAGGAGATTCGGTCCATGAAACTGGAGAAGGCTATGAAATCACGTAAAGCAGGACGAGGCGTGCGACTCGATATTACCCGACATGAAATCAAGA
AAGACTACAAGCGAGCTCAAGGTGGATCCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATAAACACGGGTCCGCTGTTACTTCGATTCAGAGATCGAGGAATAAATGGTCTACCACCTAGTCACTCTC
CACGAAGCCCTCGGCAGACAGCTACTTTTGCGGCCAGTCTTACTTTTTTTCAACGACATCCAGGCTGATCTAACGGTACGGGCTGGACGGTCATCCAAAG
CCTCCAGGTCGCCTCTGGCCCCCACCCCCCCTTCCAACGATGTAGCTTAACTGGAAGAGCGCAAAAATTCGGCCTTTGAGGATGCGTGTCCAAATCGGAT
CATCGTTATTGCTTATGCTTGGGCTAGAGGCCTTGTAGCAAAGATCAAGTTTCGTGGACAGCTCAGATCAGCAAGAAAGGTGACTGCATAAGTGTGTTGA
GGTCGGCATAGCTTAATGCTGTGAGGAAGGGTGAATACATTCTCATTTAAATGCTTGTTCCCCTTACTAGGCTCCTCAAGAACGTCCTGCGTATAGCCAG
GATACGGGTCTTGGATTGCAGCTGTCCGGTACTTCTTGAGAACCCTTTATTATTAATAGTTTGTAAGAAACCGATGGTAGCTGGCTCTTTTCGATTTAAT
TAATTCCGCCCTATTTTATTTTTAAAAAAATCAACTCGATACTGAGTGTCTCTTAATTGAGCCTTTTGATCATTCTGGTTATACATGGAGATAGTGATCG
AAGACCTAGATCCGTCGAAGCAGTTCATCCAAGCATATTGACTCGGTTTGTAGGATATCAGTTGTCCTACTTGGGCATCGCCTCTATCAAAAGCGCTTAG
AATATCGCCCGAAGCTACGTATTGATTCTTAATGATATCACAACGTACAACATAGCTCGAACTCGGGTGAATCTGAGGAATAGTATTTGAGAGTTGTGCA
GATGATATTATAGTAGGTGCCGTAGGGTAAGTACCACTAGTCAACCCAACTACCTTGCCAAACGCAGCATTATCGATAATAACACGAGGGACTCGCGTCG
TAGTTGGTAATCCCGTTCCCCCAGAGCTATATAAACCAGTAGTAGATCGAGTGTATCCAGGCGGGAGCGATGCTGGCGTAGCACTGAAATCAAACTGAGC
AGCGAATATACGCTATTTTCGGTTAGTTGAGTATATAATACATTGTTATCGGTAGAATCGATTAGAAAAGCTCCTGTGTTTACGAAAGCTGTCTGAATAC
TTCGCTTGATATCTGCTAAGTCATCCGATAGTGCTATAGAGATAGTGGATGCTGTAGCTGCGGTCGGTACTTCGATCTTGAACGAATTGTTCGAGAACTG
AGTTGCATCGATGTTATACTCTAAGTTGTACATATAAATCGACTGCACCGCGCAGGCAACATCCTTAAAACCTGCTACCGAACCTGGGAAACTATACTCT
CATGTTGAGTTGTATCCATCTTGGACAATATTGGTTGAATCAAGCTTCAGAAACGAAGCCATGTTACTAGTGTATTTTGATTCAATCAAAGTATTTTCCG
AAAGGATTGTAATAGGGCTATCAAATCTATACCAAAGCTGACCTTTTACCGAATCCACAAATAAAATCTGACCTTAACGTTCCGTGGCTTTGTTGCAGTA
GTATACGATACTACGTTCATCAACTCCCGGTATATTGCAACCATGACCAAATCACGCTTGAAATTAGCTTTTAGAATAGATACATACTCTGCATTCAATC
TAATCATCTTGTCAGTGGCAAAGTAGCTATGACTAAGGAAAATTGTGCTGAATTTGTAACGGGGTACATAGCCCTTAGTGTACCCCTAGATACATGAAGA
GTGACACGTCACGCTTCAGAAGTATGACACGTCATAAGGGAAGTGGTCAATTCGAGGCCGGTTTGCAGGTACAATTTTCGGAAAGGCACTGCTTCGGACT
AGAGATTCCGGAGGTTTCCAGAACTGTCATAAGTTTTGACAGTTCTGGAAACCTCCGGAATCTCTCTTTTTTTTAGGTGGGGATTGGCACATAATACGAC
AGTGATGGTCGCTGTATTGTTACTTGAAGAAACCACTGAAATTGTGGCGGAGGTTCAATTAAAGGCCGGAATTAGACTTGTCTTGCGTATGTTCATTGGT
ACACCAGCATCAGGTTTAAGCCTACTAGAACGGTGCATATCGGTTATACTTAAGGCATTTTCATAGGCTACTACGAGTCCTGGCCAGACATGGTGCGTCG
TACACCATCGACATGCCTTAGTCAATGACGACGCACCCGACGTTCTATGTGGGACGTCTTAAGCGGTACTTTGATCCGCACGGGGTTGCTGGCTCGCAGC
CCCACCTTGACCCAGCTCCTCAAAGCGAGGACCGTCCACAGACGCCAACGAAGGTGTCGGACCAGGCACCCAAGCGTCGGTCTGAATGGCAAAGCTGCGG
TCAAGACCATACGCAGAAGGGGTTCCAAACTAACGGTCCCCGGAGCCATACGCCAAGTACGCACCATGCGCGTACGACTGGGAGTGCGCCGAAGTCGGCT
GCGGATGTGGCAACAGAGCCTTGAGCCGTCGGATCATGCGGAAGGCCTCGTCCAGATCGGACGAAGAGGTCCGTCGATCCACCCGCAGACGCAGTCTCGC
GACCGCACGCTCCATAAGGTCCAGGCGGCCCGCAAGACGAGCGATCTCGCCCTGATTCCCGGCCTGGGCAGCAGCATCACCGCCAGTCCCAAGGCTTAGC
GCAATCTCAAACACGATGACACGTTGACGGAGGAGGTCAACCTCAGGGCCCTGTGTCGGACCCGCAGGAGAAGGACTCGGGTGAGAGTGGCGTTCGGGAG
GCGCCGAGTACTCGTACTCGTACGAGGGCACCTCCGCCCTGCTTGACCGGAATGGAGAAGTCCACTTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN