Description :
From Genome Similarity Track
Location :
Scaffold_54:70692- 72524
Transcript NameFunction/comments
Phyci_93562hypothetical protein

Sequence
1832 bases(100 bases per row)
GCAGTCGCCTATACTCACGCCGCAGCTGACGCCGTCCGTCTCGGGCTACATCAACACCAAGCTCTGGGATGAGCGGCCCGTGCGGTACGCCGCCAACGTG
CTCAAGCACGTGTGCATCTTCCTGCTGATCCTCACCGCGTGCGAGGAGGTCACGAGCTTCGCCATCGGTCAGTCGCTCAAGAACTTCTTCCAGAAGCTGG
GCTGGTCCAACAAGGGCTCCACGTCCATGAAGCTGACGTACGATTCCTTCAGCCAGTTCATGTGCATCGTGGCCGGCTACATCGCCGACGAACGGCTGGG
CAAGTTCAAGACGCTGCTGTCGGCCGCCACGCTCGACTCGTTCGGCCTGCTCTTCCTCGTCATCGCCGCGCTGCCCGTGGTCGTCAACAACCACCTCGGC
GTGAGCAAGGCCATCTTCAACGTCGGGCTGTTCCTGGGCGTGGCCGTCTCGCAGATCTGTCTGCGGTCGCTGGTCATTTCGTACGGCGGCGACCAGTTCT
CGCCCGCTGCTCCTCCGGCGGAGAAGGCCTTGTTCTTCAGCATCCAGTACTGGGTGGCCAACATCGGCGCATTCATCGGCTATGCCGTGTTCCCGTCCGT
GTCTATCCACGGCTTTGGGGGCATTCCGGCTGAGTACGGCTACGTCTCCGTCTACCTGGTCGGCTTTGCCATGCTGGTGATCTTCGTGGGCCTGCTCTGG
TTCACGCGCAACCGGTACGTCAACGTACCCCCCACGAAAGAGTCCATTGCACTCGTGATCAAGATCGTGGTCCACCACGCCAAAAAGAACTTCAACGCAC
AGATGGTAGTGCTCGGCACGGTCCTGTACATCGCCGCCTTCCTGCTCAACATCCTGGCGTCGGTCTTGTCGGACCACGGCGAGGTGGGGCACAACATCTC
GTACGCCTGCGGCGTGATGATCGTCATCGCCACGGTCCTCTGGGTCTACTTCGGCCAGAGCTCCGAGTTCATGGAGTCGGCCAAGGACACCGTGGGCGGC
CGGTTCGACCCCGAGCTGGTGGACGGTGTGAAGCAGGTGATCCGCATCCTCCCGTTCAACGCCTTCAACGTCTTCTGGTGGGTCTGCCAGAACCAACGCG
GCAACAACCAGTCGATCGTCCAGCAGACCGACACTCGCCTCGGGAGCGGTCCGTTCTCGAGTCAAATGCCCGGACCCACCGTTCAGATGTTCAACCCCAT
TGGCGTCTTGATCTTCGTGCCCCTGATGGAGAAGGTGGTCTACCCGCTCTACGAAAAGCACGCGGGAAAGCCCGCAAGTCGCTACGGCAAGGTGCTGGCT
GGTTACTGCGTGGCGGTCATCGCCATGATCTGGACGGGGTGCTACGAGATCATTCGACGCAGCACTTCCCCGCTCACGTACGTCGACTCGGACGGCGTGA
CCCAGTTCATCCTGAACGACGACGGTAAACAGGTGATGAACGACATCCCTTGGTGGACGGCCATCCCGCAGTACCTGCTTGTGGCATTGGCTGGTGTGAT
GATCGCCATCCCGTCGTACGACATCAACTACTCGGAGGTGCCGCAGAGCATGCGCAGTACGTCCATCGCGCTTGGATTCTTCGTCAACTCCATGGGTAGC
ACCCtgctctccatcatcgtgctgctcttcggcaagtacatcccgtccaacctcaacaacggacatatcgagtacatgttcttcacgctggctgcggtca
tggtggtgaatattttcttctacgtGGTCATTATGACCAAGATGCAGCTGGGTATGATCCCCCGCGTCAAGAAGGCTGGCGAAAAGGGGTCGGAAGAAGC
CCAGGCAGGAGATGTGTAATTAAGTTTAGTTC