Description :
From Genome Similarity Track
Location :
contig_24:706591- 723690
Transcript NameFunction/comments
g4671.t1Major Facilitator Superfamily (MFS)
g4672.t1hypothetical protein AM588_10006583
g4673.t1hypothetical protein F442_07900
g4674.t1hypothetical protein F442_07899
g4675.t1hypothetical protein, variant
g4676.t1protein-l-isoaspartate o-methyltransferase
g4677.t1hypothetical protein PHYSODRAFT_354854
g4678.t1hypothetical protein F443_07975

Sequence
17099 bases(100 bases per row)
TCTCCGCGCGAGACGGCGGGCGAGATCTCCGTCAGCAAGATGGGCACCGTGTTGGTCACGACGCCCGACGCTAGCCCCACGAGCAGCCGGCCGGCGTAGA
GCTCACGCTTGGAGGTGGCAAGCGCGCAGACGGTGCTTCCGACAATATACAGTACGTTGTTGACTAGAATGGTCTTCTTCTGGCCCACGCGCGCACCCAC
CCCGCCTGTGGTAAGCGCCGAGAGCACGCAGCCGACGACCACGAGCGCCGTGGCGAGCTCCTGCTCCTCCGTGCTGAGGTTGATGTCCACGAGGATGGAT
CCCACGGCGTCCGGCACGATGCAAACGTTGAGCACCGCGGCGCTGAAGCCCCACATGAAGGATGAGATGGACACCAGCCACGCCGCGAGCCGCAGTTGAC
CCGTGCGGCCGCAGCCCACGAGAGACGCCTCGGGACGGACGGGCGCAGCGCCAGGCTTCGTGGATGCAGCGGAGCGACCGCCACCTACTCGCAGGCGCTG
GCGCTGCGGAGATACGGGCGCAATCTTGGGCAGGAGCTTCTCGTGGATGTCGACGTGGGCCTCCATGAGATGAAGGCGATGGTTCTTCCGACGTTTGCTT
CAAGGAGGAAAAGATGCACCACACTGTGTTAACACGAGGTTGTGTGTCCACACTAGATTCAGATGGATGCAATCGTTGGGCCAGTCATCAGGCGCGTGTC
TTTGCGGAGAGCGAATCCGATGGCGTGCTGGCAGTGCTGTGCAAATGCAGGGCAAGCCTTTGATGCGCGGGGCGTAGATGCCAACGCTTTTGGGCCAGTG
GTGCGTAGCTTTTGGGCCAGCATCTTTTGGTGCTTGTAAAGCACTGTTTCATTTACATTTTGTGTATTACATTGAAATGGGCCTATTATTGTCTGTTCCA
GGACGACGCGACAGCGTGTTTCGACCGCATAGATGCGCGACAATTTTACAGTACAACTTCAACAATTACCGCGAAAAGCTCATGTTCGCATAAACCTACC
AGGCAAGCTCGTCTTAACATTGAAAAGTCTTTGGAGCGGTAGTTATGTGTCATCCCGGGCCGTGATTCACGGCTCGCTCCGCCCCACCACCGTCGGAGCA
CTGCCGACTGTATTGCTGCCGGCGATGCGAGCATACCGGCGGGCGAACTTGCCAAAGAAGCTTCGGCTTTAATAAATCGACGTCTGCTTTTCATTGCGAC
TGCAGCCGTCTAACGACATCCGTCGCGTCGAGACGGCAGCACCGTGTCGTCATCGCCGGTTTACCAGTGTAGCAAGCGTGCATTTCCCGGGATCCAGTCC
ATGCAAGCCTGAACAGCGCGTAGCGCAATGGCACAGAGCGCGTTAACTTATGGCTGGCGGCAGTCTCTATCTGGCATCTTTACATGGAGTAGCAGTGCTG
CTTGGGGGCCCAAGTAACGTAGCAAGTTGAGGCAGCACCGACAAAGCCACAATAGTTGCCAGCATTAATGCCAGCACTATTGCCGGCACTAATAACAGCG
CTGAAACGCCAGCAGCATGGTCCAACGGCGTTAGGCTTACGGCGTTAGGCTTATGGCGTTGGGCTATTCTGGACTCGGCCTGGGACCGCGGGCACGGATG
AGTGACCATGCCTTCCATGCCGAGCTCGCAAGCACTGCAGCCGCGGGCGATAATCATCCAGATAGGGTGAACGAATTGGCCGGTCGACGCCGTGCCCTGC
AGCGCGCCAATTGCAATCAAATCGTCGACAAAATTGCCTTCGGCGAGATCCACAGCTGCCTCTGAAGAGGTGCATGCGCTGTTGCGGTTTCTATGCGTTG
GACCTGTCTCCGCTTACAAAAATCAAGTCAAAACCGCCCAGGTCGGGCCCTAGTCCCTGCCCATCTTGCTGACTCTCTCGCTGCGATTCGCGCAAAAGCG
GTCGAGGTCTGCTTTTCGTCCAATCGGCGCGCGGCACGACCGTCGGCAGGAGCCCCAACCCGTTTTACCCTTCTCGCTCCAGCAAGCAAAGGTCCACGGA
AGAAAAGCCGATAGGGAGCCGCGAGCCCGCTAGAACGCAAAGTGCTCGAAACAAGAGAGAGCAGAACAGGAAAAACAGGAAACAACCACCACCATTGACT
CCCAAGGAGCACGAGAATGTGCCGGCCGATAGAGTCCCGCGATTCGCTGGGCGCCATGGGCCCGGCCGCCGTCGCGCTCTTCGCTGGCTACCAGCCCTCC
GCCGCCGTCGCGGCGACAAACAACAAGGCCATGCTGAGCCAGAACGTCAAGGCCTCGGGCCGCGCGCCCGCCTGGTCCACCGCCGGAGACTTGGGTTTCG
GCGCGGACGGCATGAACATGCTAAGCATGGCGGCGCCGCCCCGGCGCTTCCCTTCGTGTCCTTCCCGAAGCCCAACAGCCTGCCGGCCATGCCGTGGGCC
GCCGCCGCCCCTTCGACCGACCTGCTAAGCCTGGGCCTGCCCAGCGACCAGTTCGCGGCCGCCGAGACCAAGCCTGAGGCCGTGCAGCCCAACTTTGAGG
CCCAGGAGCTCGAGGAGCTGCTGGACTTCTCGATGCCCGGCGAGATGGAGAGCGTGAGTAAGGACAAGCCCGACCTCGTGAACCTGGACGATGGCTTCGA
CGGCACGGAGATGTCGATCCTGTACAGCTTCCTGGTGGACGCGCCCGAGGACAAGGCCAAGCAGACGGCCGAGATCGACGACGGTATCCTGAACCTGAAC
GTGCTGGCGGGATCCCCCATCGACGGCCTTATGGAGTCGTTCGAGAGCGACTTCACGGACTCGGAGCTCATGATGACACCGCGTCAGCCGGAGCCCCACA
TGGTCGGCCCCAAGACGCTCAAGCCCGGCGAGGTCAAGAGCCGTCGCCTCTGTAAGAGCGAGGGCTGCTACAAGCGCTCGCGCTCGAACGGCCTGTGTAT
CTCGCACGGAGGCGGCCGTCGTTGCGCCGTTGAGGGCTGTGACAAGAGCTCGCAGGGCGGCAACCTGTGCATCCGCCACGGCGGCGGCAAGCGCTGCAGC
CACGAGGGGTGCGACAAGGCCGCGCAGTCGAACTTCCTGTGCAAGGCCCACGGTGGCGGCCCGCGCTGCCAGTTCGCTGGATGCTCTCGCAGCTCGCAGG
GCGGTGGCTTCTGCCGTTCGCACGGTGGCGGCAAGCGCTGCATGTTCGACGGCTGTGACAAGGGTACGCAGCGCGGCGACTACTGCGCTCTCCACGGCGG
CTCGCGCCTGTGCGAGGTGCCAGGCTGCATGCGTAACGACCGCGGTGGGGGCCTCTGTGCCACCCACGGTGGCGGCAAGCGCTGCACCATGGAGGCCTGC
AACAAGCCGTGCCGACGCAAAGGCCTGTGCTCCGCACACCTGCGCCAGGTGGAGGGTACCAAGTAAAGGACGGGTTGATCGAGTGGAAGTCGCTCCGCCC
TTGCCGAAGTGAAAGACGAGGAGAGGACGACGGTGATGGTGGGACGACGACACGGGACAAAGAAGGAAACGAGGAGGGGAAGGGAGCGTGGGAAGGAGGA
ACTGAGGGTGGAAGGGAAACTGACGGGTCTAGTGGCGTTGGAATCCTTTGCTGCCACTTGGTCGGTCGAAGTCGAGCAGCGGCTTCAGTCTCTTTGCGAT
GGAGAGTGACTTCGGCCGACGGCAGCAGGGGAGGCTCTGCATTATTCATATGGTGTATAATTGGCTTGGCGGATGCGTGCGAGCGTGGTCCGTTGCGACG
AAGGAAGGTCAAGAGTCATCGAGTGGTGGCGGAGTCGAGTGGCTGTCCCGACCAGTTTTTCCAGGAACTGAAGGGGGTTGAAGGCTGGCGAGACCGAAGC
TGAAGGTGAGTCGGCTCAGCAAGGGATGGTCGTTGGGGCCCCATTCGAGCGGTGCTTTGGTTCTGAAGCGTTGGCGGTGCGCATGCTGCTTGCAGTCCGT
CAGCTCTTCTTTATTTACAGCGAGGAAATGTTGGAGTAATGCCATTTTGACCTTTTAATAGCGTGGTGTTCAAGTCTCATATATAGTAGCAATTCTTTAG
TGCATGCGTTCTTATGTGTACTCGGCTGACTCATCTACGAGCGCTGGGCTGCACTCGACACTTGTCGAGTCGAGTTGGCGGGCGCAAATAGATGCCCGCA
CCGTCGGTATCGAGTGCAACCGCCAAGCGCACAGCTCCAAGCAGCGATACTGTTCTTTTCGAGACAAGATCTACACGACGACAAGAGCGGCGGAAACGCG
ACCGTTCAGATTGCCTTTGCCCAGCAGCGCCTGACCAGCGACGTGGGTGCGGATTCAGTGCGGTGGCCCATGTAGCGTGGCGTCAGCGACGCCCAGCTCA
ACGAGCGAGTCGCTGAGCTGGGTGAGGACAGCCCCTGGCCTACATCGCGCTATGTTGCCACTGGCCATTACGATCACCTCGGGCGCCGATAGAGCCTTCG
AGCGTCATGAGCGAAAGCACTGTTCTCCGGTTGAAGTTTGTTCGTGGTCTCATTTGTTTGTGGTCCCAATATAATAGAAAAAATAATGGAAACATAAAAA
CAATTAATATACCAAATACGCATATAGACAATATTGCTACTTTGGCGTCGTCCACAAGGCCAAGCAATACAGGTATGGCGGGACCCGATGCGGACGATGC
GATGCCTCGCGCCAAGCGGCTGAAGCTGTTGCGCGAGGCCAAGATCCGCAAGGAGCGTGGCGAGAGCAGCAGTGGCGAAGCTGGCGCACTGGTGGTTGCA
GGGGTGAAGCCCGTTGAGGACGAACCAACGCAGCCGAAGGACCAGGAGGACACCGATATGCCCGACGCGGACCAAGCTCCTGACAAGACAGAGGACCTCG
TGGAGAAAGTGGCTCTGGCGCAGGAGGAGGACGCCAAGACAGAAGACGAGAGTGAGGACGAGCTGCTGAATTTGGCGCCCAAGCGCGCCAACTGGGACAT
GGAGCGCGACATCGCACCCATGCTGCGCAAGCTCGAGAAGCGCACGCAGCACGCAATCGTCGAGATCTTGCGTACGTTTGGAGCTCAGCTTGGCACGTTG
TTTTGAATGCTCATGTGTCTAACAATGGCTCTGTGGAATTGCAGGTGAGAAGCTGGCAGCAGAGCAGCAGGAGGAAGACGACGATGACGAGGAAGAAGAA
GAAGAGGAAGACGAGGAGGTGGAATAGCGCCGTCATTTGCAGTGCAATCCTATGTACTATGATATAGCGCTTCAGTGCACCGTCTGGGACCAGCAGGGTT
TAACCTGGTCACCTAGGTGTTCATTTAATGTCTTCGCTTTTAGCCTTCTGCTTTTTAAGCTTCTTCTTGTCATCCTTGGATCCGTTTTTGCGCTTCTTGT
CCTTCTTTTTGCCGTCCCCTTCTTCTTCTTTTCTTTCTTCTCGTCATCCTTGTGGAACTGCTTCAGCTTCTTGTATATCTGTTTGACCTGCTTGCCGCGA
TGCTGCACGGCTTGCTCGCCGCCCTTGTCTTTTTCTGCTTTCAGTGCTTGGAATGCCTGCTTAATCTGCTGAAATCGACCCGTTACCTCGTCGACCGGCT
GGTCCTTAGAGAACTTGCTGCGTTTCATGTAGTCCAGTACATCAGCACTAGTGAGTCCGCACGCCTTTTCACCGCTGCTAGCAGCAACCTCATCCATGAC
ATGCCATAGCGCTGCAAGCGCCAAAACCGACGGGTAGTGCAGCAATGGCAGGTCTGTGAGCAGCATGTCATTGAGCAGTGCGGTCGAATTGGCGTGCAGC
TTTTGCAGGACGGTCGCAGGTAGATCCTTCGACAGCACCTGCTTGGCGAAGGCGCGGAAGTCGTCCAAGAAGCCCAGCAGCGCACGGAACGGGTGATACA
TGATGAGCTGGAAGCGCACGCCCTCAAGCAAGATCATCTCGTGGCCAATGATGAACTTGTGGTCCACGTGGAGCTGGTCAGCAACGGTGTCCACGGACAT
GTACTGCTCCTCGACCTTTCCCGCCACGTAGATGGCCGTAGGGACGAGAAACTTGGGGTGGAACTCCATCACACTGTTGCTTAGATAGAACCTCTTGAAT
AACAGCATGGCGCAGCACTTGACCTTGTCTGAAGTGCGCAGGAACTGGGCGCTGCAGCTCTCCTGGATCTTCTCCTCGTAGAAAGCTCGGAGCAGCGCCT
CCTGTTCCGGATTCAGGAACTCCAACAGCGGCGTCAGTTGCAGATTGGCCTTCTCCTCCGCCTCCTCCTCTGTACTCAGATCCATGTTCACCTCGTCGTT
CCAGTCGAAGGCGTCGCGCACTGCAGTGGACGAGCGCGGTATTAGAGCCGAAAAAGACCGCGCTTTGCGGCTACTGGCGGCCGCCGCCTCAACCTTCTGC
GTTTCCCCGCGCTCTAGACGCAGCGCGCGCTTCGTCTTCACATGCTGCAGACGACGCACACGCGCCAGCTCCTCCGCCGAGAAGACCCAGTTGTTGAAAT
GCGTCGACGTCGAGAGGTACGACATGCTGCCGATCTGCCGCAATTGGAGTGCTGCGGATGATATGACACTACATGGGGTATGCTATATTAAAGGTGAGTG
TGTACCACACCATATTGAAGTTGGGTGACGTCGAGCGCATCGATGATCTTCTCATCACTTGAGTTTTGGCCATGTGGGGCGCTCGTTTCGCGCTTCGCCA
GCCTCTCGGGGCCAGGAGCTGCTCGTCACCGCGTGTAATGACGGCGAGGAAGGTGGCGCTGCAGCAGCTGCCGCTCGTGGACGTATCTCCGCTGGTTGCG
GCTGCCAACAGCGGCGGCGAGGTGCCACCCGAGACGAAGGCGCAGATTTTGAGCGACATGCGCTCAGCATGCATCGACACGGGCTTCTTCACGGTCCCCA
CAAAGGGAGTGCTGTCCAGTCGGCTCGTCCAGGCGGCATACAGTCGAGCTGACGAGTTTATCGCGTTGCCGGACTCGGTCAAGCACAAGTATCACTGCAA
GCGCTCGCCCAATGCTCGAGGCTGGACGCCCATGTTCGAGGAAGCCATCGGTGCGATAGAATTGATATTGCTATGGCAGAAAGGATAGGGTGTTGATGGC
CTGGTTTATGCTGCAGTACCAACCGGATGTGGTGTCCCACTTGGAAGGCTTCGATCTCGCCAGAGAGCTCCCCGAGACGTACGTGAAGGAGGGATCGAGC
TTGGGTCCTAATGTCTGGCCAGCTGAAGTGCCACAGTTTCGGGAGGACGTGTACACACTGTATGAGGAGACTACCAAGCTTGCGACGGTGCTGTTTCGGA
GCTTTGCCGAGATGTTCGGCCTTCCATCGTCCACGTTCCTGGTGCGAAAGCGATTTCATATACTAAAGCTGGCGATAGACGGTAGTGACTTTCTTGATGC
TGTAGCAACACGTCGATGAAGAAGCTGAAGCTTTCATGCGGCTGCTCACGTATCCAGAGATCGAGGCGCCTGCGAAGAACTCGACGTTGGGATCGCCTCA
CACACCGACTTCGAGTGTTTCACTATCATTCACCAGAACGGCGAAGGACTGCACTTGCTGAACCGCCAAGGCGTTTGGGTCGAAGCACCTGTGTGCGATG
ACAGGTACCAAAAGACTTGGCTCACGAACCTGTCGTTGGACTAACTTGCCCTGTTTTTTTCTACTCCCAGACTCTTTATCATGGTTGGCGATATGCTCGA
ACACTGGACTAATGGCGCCCTAGTTGCTACAGAGGTAAGCTCCGCAGAAACGACGAGTCAATGCTTTGTTTTGATCTACATATATCTTGTCTGCAGCATC
GCGTGTGCAACTCGGAAAAGAAGCGCCAATCCATCGTGCGCTTCAACGGCGCGAACGGTGACACGGTCGTGGAGCCACTTCCGGCCTTCGTGACACCAGA
AAATCCGCCTCGCTACGCGAGAATGACGCAGCGCGAACACATTACCCACCAGATCGAACTGGCGGAGCAACTTCTGCAGAAAACCAAGGCCGCGGCGCAT
GCCTGATGACACAGGTCAGCAAACCTCACACACGATGAAAATGGCGTCGTCAATAGCCGATAACCGTGACATTGACAGCTTGATCCCAGTAATCTTTCCT
CTACTTTCGCAGCGCTGCGAACTCTTGGAACAGCTTTTTCGACTCAGCATTGCTCATAAGATCATCTCGCGTGGGCTTCCGTCCGTTCTTAGCTTCAAAA
TCCTCACGCCACTGGGTAAGGGCCTTCTCCACGCGCGTGAGTTTCTCGGTGCGCGTCTCCTGTACAACCTCCACGGGCACAGTGTCGAGTATAGGCTGGC
AGAGAACGCTCATGATATCGCGCTTGTCTACAGTTCCATCAGCATGCTTGGTCATCTAAAACCACAACGTACACGAATTTATGAGCTCAGTGCAATCCCT
TCCTCGTCGCTCCTCTTTACGACTCTCACCTTGACCAGCTTCTGCTCTGCACCCGCCCCACCAAGTGGGATCAAGAGTCCACCTCCAGGCTTCAGGTACT
CCAGAAAGCTCTCGGCTTCAGCCTTGGTTTCTACGGCAACACCGACATGGATGCAGTCATATCGACCATGCGATGGGAGGCCGAGGTCTCTCTTGCCTGT
ACTCAGTAAGATCTCTGTCTGCTTCTCCGCGTCCTCTTTACCCAAACTGCGCTGCAAATTCTGTTTCGAGAACTCCACGAGCTCCGGCACAATATCAACG
CCCGTGACAAAGCCCATAGGCCCCACCAAGTGAGCCATAGCAGCCACAAGGATGCCTGACCCGCAGCCCACGTCCACCGCAGTCATCCCTGACCGCAGGT
GCTTCTCCAACAGCCCCAGCACCTGCGCGTGCTGCTGCGGGGTGGAAATCGTCGCTACCGAGCCGATTTTCAACGGGCGATTAGCATAGCGATCGCTCGA
GGCTCGAAACGCGGGTGCCACGAAGTCCCCACGGTCCACGCGCCTCAACGCCGCCTCCAGTCGCGAGCCAGAAGCCACCACATTCGTCCGGACCAAACTA
TCCACCAGCGCAGCGTGCGAGTCGCCACCGATTTGATGGCCGATGCTGGTGCTCACAAGCAGGTCCTCCGAGATGCCACTTAAGACGCTCAAGGGCGGGA
GGCGCCTGCACGAGACGAGCGCCACGGCCGGAGCAGCGACGACATTCCTGATCAAAATCTGAGGTGCTGAGAATATAGTCCAGGAATTTGTAAAAAATAG
TCTTCAAATTAATAACAGCTCAAATTCATGGTTATAGTTTTGGGCTCTACACGATTGGAACGGCCCAAGCTCCGTGGCTCTCGATGTTGTAAATGTTAAC
GCCTCTCGGCGAGGAAGAAGCCGCGGTCGCCCCAGTTTGTGCCGTCCGAATTGCGGACGACCCAGTACTTGACACCAGTCTTGGCGTCGGTGCCCCACCC
GACAAGACTCACGACATGGGTCGTGCCTGGGTATTTCGTCGAGTCACGCAAGATGTAGCCTCCTTTGAACTGACGGTACTCAGGTGATAGCGAGTACATG
CTCACAACAATCGGGCCACGATGGTAGATCTCGTTCATGGCCTGCAGTTGGAACTCCTCGGACGTCGTGAAGTTGAGCGTGCCGTACTCTGAGATGCGGT
ACTTTACCGGGTCTTCGAGCACGAAACACTCACCCTTCAGGTTGCACGTGTGGCACTGTGTGGCAGCACAGTCGCCGCCGCCCATCCAGGACGGGTGCGA
CGCAATGTATGGGTTACACGTCAAGTCCACGATACCATTCTCGTGGATCCACTTGTGTGCATGCCGCGGGTCTCCACCGTGGCAAGAACCAAAGGATCGC
ATGCCACAGTCCAGTAGCACCTGAGGCGACAGTAACACCTCGGTGTCGAGTCGCCCGGTCTTCTTGAACCGCGCGATGCGGATACGGTCCGACAACGCGC
TGACTGTGGCGAAAGCCCAGCACGACCCGCACGCACGGGGCACCATTTGGTTCATGATGCTGGTGGTGAGGCTGATACCGGTGCCGTTGTAGTCCCGCCA
GTCCCAGTTCTCGGGCAAGTCGTCAAAGGAGCGAACTTCCTGCAACGGTGTCAAAACGTGTTCGGGGTCGTTGCCGCCAAGGAACCAGCCGGCTCCTTTG
TTCGTTTGGACCGTCGCAACGCCACCCTCGCCGGTTTCAGTGCCAGCGGCAGCACACGCCGCCATCAGATCGAGCTGGTCTTGCACGGCGTGCATCGCGA
CCCCGTCGTGCGTGTAGTCGGCGAGTTGCTTGGGTGCGAGCACCGCCGAGTTGACGAAGCATCCCAGCACGATCCAGCCGAGCACTGAGCCAATGGAGCG
CAGTCGGAAGCGATCAGCTCGGAAGTTCTCCCAGCTTGACTGCAACAGCGACGACGTTGAAGTCTCAGGACCGTTGCTGGGGCTGAGGAGCGTGCTGGTG
CGTGGCTGCAACAGCGGCAAGTCGGACTTGTCGGTGATCGCCATGGGGCTGCTGGAATTGGTCTGGAGACTGCGGGAGAAAGTTGAAAGTGAGCCGCGTA
GGGCTGCAGAGGGTGAGCCATGTTCTTCCAAGTCTGACGAGGAGCTCTTCTCGTCTGTTGGAAGGACATCATCTGCTCTGTTGGCGACGCGACTCCATGT
GATTGGCCGAGCGAAGCGGCGTGGACCAATCAGTGGAAAAAGAACTTGATCTTGAAGTAACGGCTCGCTAGGATGGATACACAGGGGTGATCGACGCGGG
AGGGACAACGCCCAAATCTTAAAGCTGGTGATGGTGCAAATATGATGCAATGGTCAGGCATGAGTCAGGCACTCGAGTTGTTGGCGGCGCCGTCCCCGCC
CGCGTCCCAAGCAGCCATTGCGACGGGCGTCCAATGGTCAAGAGCTCCAGGCTCCAGTCACGCACGCTACGGAGTTGATGCTGACACTGCCGTCGACGCA
ATCTGCCGCGTTAGGTGTGGGTCAGGTCGGCGAGGAATTTCGTGTCAGGGTCCCCGCTGTCTGCGGTGTCACGATTATGGACGTCTTGGAAGGATGCTGT
GCCGCACAGTCATGCTGCAGAGAATAGGCACGAGTGCCTGACCAAGGCAAGAAAACCTTGCTCGCTGGGCGATAGAGTTTGTACCTGAGTGATGGTATGG
TGTTTGGTGTTGAATGTACACAGTCGCTGCGCTGCGAATCAAGTGGAGATGATGTTTTCTAGTACTTTTTAATCGTCTCCTCACTGAAGTTTCCCACTGT
CGACAATGGTACACGGCACGCAAGGCCGTTCCTGGCGAGTTTCCAGACTCCCGATTGTCATGATCGTGCGCCATCCGCTTACAACTCGGCCAAATGCCAC
TGCAGGTCATCAAAAGCGAACAGTGTACACGTTAGTTTCAGGATCGGTGAACTTGGCAAGAAAGACAATAACTTGCAGTACCCTTACGGCGATCGAGCCA
CGGTTGAGGCGAGAGGGTGATGAAGAATTGGGAGCCGTTCGTATGTGGGCCTGTATTTGCCATTGACTGCAAAGAAACTCGTTAGACCATTTGTGACTGA
TGGACGAAGGTTAGTTTGTAGGTACGGACGTACAAGGATGCCAGCAGCGCTATGCGAGATAGCGAAGCTCTCATCACCAAACTCGAGGCCGTAAAGAGAC
CGAGAAGGCCCGTCTCCTCGACCATTACCAGCCACATCACCAGCTTGGATCCAGCCGCCACGTACAACGCGGTGCACCGGGTTGTCCTGGAAGCCTAACT
GTTGTGTTTCATCGTTGATGTCAGGGACCTTGTGCTCACAGAACGCCAGAAAGTTTTTACATGTTTTGGGGCACACGTCCTGGTAGAGCTCAAGTTCTAC
CCGCGGCAGCGCCACACCATCAACTTCGAAGACCAGAAAAGCATACTGATGTCCAGACGACTCGCGATAATGAGCCAGAGCTTGTTGGGCTGCTTCCTCC
GCTTTTGCCTCCAGCGTTTCTTCCGCGAGTGCCAATTTCTCGTTATACTCTTTCCGTGCGCTGTCATTGCCATCGCTATCATTCCCGAGCACGGGCATCC
CATCAAACGCTGCAGCGGCTAGCAATTCATTCCTCGAGAGTTGTGTCCGTTCCATTGCGAAGTCAAGCAAGTCGTCTTCGCCGTCTAGCATGTCGTTTGA
GGAATCCAACAACAGTATGATTGGTCGAGTCGTTCGAAGCAGCTCTGCACGCCCGCTCTTGGGGATTTTCTCCTGCTGGTTTTGCAAATACTCCAGGTAT
TCAATCTCCATCATCCCTTCCAGCGGAGACACGAAGATTGGGTGCAGCTTCCGCAGCTCATGGAGCAGCAATCTACAACGCTGGTAAGCCACGTCACCCA
TGAGACCCACCAGCTCGCAGCACTCCATTACAGCCCCGCCTGTCGTCGCCATGTTAAGACACTACTTTGTCTGCTTCAAACTAGCACAAATGCCAACTGC
AGTCCGTTTGCGTCGCGTCCCCGCAGGTTTATTTGCGGCACAAATGGGATGAGCCTGAACATACACAACCACCCCAAACAAGCACAGCATCAACTTCAAG
ATACAACCCACCATGCGGTGTTCATTTCCGATTGTCTCGTATCTGCTCTACTCGGCCACTCGACTCGAATAAGATAGTTCGAAAACGCGCACATCGGCGC
CAGATGAGAATGCCCACAGCACGTAACAGCGCTCCGATTTAAACCTTGCTGTAGTCCATCTTGGACTCGAGCTTCTTGGTCTCAGCCAGTTTCCGCGCAG
CCTTCATGAAGTCCTCCTCCACAACGTACTCGCGATCAGCGCGGATAGCGAACATACCCGCCTCCGTACACACGTTGCGCATATCGGCACCGTTGAAGCC
ATCTGTGAGCTTGACAATAGACTCGTAGTCAATCTCGCCCTTCTTCGTAATGGGGCCAGAGTGAATTTTGAGAATATCCATGCGCGAGGCCTCGTTAGGC
AGCGGGATCTCGATCTTTCGGTCAAGACGACCAGGACGCAGCAGTGCCGGATCCAGAATATCCGGTCGGTTCGTAGCCATGACCATCTTCACTTGTCCTA
GAGCGTCGAATCCATCCAGCTGGTTCAGCAGCTCCATCAGCCGTACGCTGAATTTCACGATCCGCCGATGTGCCTTCCGAGTAACGACTTCCACCGATAG
CGTCGATCTCATCCATGAAGATGACACACGGCTGGTGGTCTCGGGCGTACCCGAACATCTCACGAATCACACGGGCGCTTTCACCGATGTACTTGTCCAC
AATAGCACTAGCCACGACCTTCAAGAAGGTGGCGTTAATGTTGCACGCGAGTGCACGCGCCAGCAGCGTCTTGCCCGTACCCGGCGGGCCGTACAATAGC
ACACCCTTGGGCGGCTTGATACCAACCCGCAGGAAGAGCTCCGGGTTGGTGAGCGGCAGCTCGATGACCTCACGAAGTTCGCGGATCTGCTCGTTCAGTC
CACCGATGCTCGAGAACGACACGTTGCCCGCGTCCTCATTCAGCATGTGGTACACTGTGGGGTCCACCTCACGCGGCAAGTAGCGCATAATGGTGAGCGT
CGTCATGTCCAGCGCCACGCGCGTACCCGACTTGAGTTTGCTCTTCTCCACCTTGGCGCGGCATCCCACGACGTAGCGCGGGCCGCTCGACGCCTTGACA
ATGAAACGGTCCTCGTCTAGCTGCCGCAGCACTTCACCAATGATTTGGCCCACACTCTGTAGAGATAAAACGTCGTCAGTTAAGGAGATAACAACGTTTT
AATAGAGTAAGACTGCACCTGCAGAGCCTTGAGGTCATCCTCCGTCTTGTTGAACTCCTTCACGAGCGTCTTGACGTTCTCGCGCATGTTCTTTACCCTG
TTTTACATGGGGAAATGTCGGTAAATCGTGAGTAAATAGCAGAAGAAATTCCAGCAAATGAAGCGAAAGATCGCAAGCGACTGAACGAAGGACATAGAGC
GCTATAGAGAGACATGTTTGCATGCAAAGAGAGCCACACACCTGCTCTCCATCTCGCGGTGCTCCATGACCTTGGCCTTGTACGCGTTGAGCACCTGCGT
GCGCTCATCTTCGGTCGGCACGGACGCCATCTTCGCCTCACTGCTTCGAATCGAGTTCTCCCCTTTTTGGATACGGCACTGAAAATCACCCAATCAAAAT
CGCATAGATATCTAATTGGCTGAAAATACGCCTGCGTCAAGGGGCACATCTTGTCCAGCTAGCGTAACCGCCCATTGATACACTCGCCGCGCGAGACTAC
AGGTAACAACTCAGACATCCAGCAATCAAGAAGTCGAGCGCCATGGATCGATTCCTGCTGGCTGCTGGCCGCGTGAAGCCTCTGTCGCGCTGCGAGATCG
GTGCAGGATCCTTGAAGAAGTGCCTGACGCTGGTGGATCTCGTAGCTTATGGCGTGGGCTGCTCTGTGGGCGCTGGCGTCTACTCGCTCGTGGGTGTCGG
CGCTCAGATCGCGGGGCCGAGTATATCGCTGTCGTTCCTGATCAGCGGCCTCGCCTGCATTTTCACGTCGCTCACGTACTCGGAGTTCGCATCTCGCGTG
CCTGTACGTTGCGTCACAGTCTCTGGATGGCGGTGGATGAGACTCTGATCGTTGTGTGAGTGAAGGTCACGGGCTCAGCGTACACGTTCGTGTACATTAC
CTTCGGCGAGCTGGCAGCGTGGCTTATTGGCTGGAATCTGACGCTGGGATACGGCATCTCCGCAGGTAACCATGGATCGCTGCTGTGGTTGGTGGAACGG
GCGACTCATTGTTTGTGTGAATTCAGCTGGAATTGCTCGTAGTTGGGCCTCGTATGCGCACTTGTTCCTGCAACACTTGGGCCTTAACCTCCCACGTTGG
CTCGTGCAGGTGGAGTTTCTTGGCGTGTCGTGCAGCATCCTAGCGGCATTTCTCGTGATTTGCTGCACGTTCATCCTTCTCGCTGGTGTTCACGTACGTA
CTCTGAGCGAAGATTTGGTTCCGGTGTGTACGCTGATTAAAGATCGTGCAATTCACAGGAATCTGCCAAGTTCAATGCGTTCGTGACGTTTCTGAATATC
TCGGTGCTGCTCTTCGTCGTGGCGTTCGGAAGCACAGAAGTGGATGCTGCGTACTGGGAGCCGTTTATGCCTACAGGGATACATGGCGTTATGACGGGTG
CTGGTGTGGTCTTTTTCGCGTATTTGGGCTTTGACATGGTGGCTTGTCTTGCTGAGGAGGTGCATGAGCCCCAGCGCACGCTGCCCAAAGGAATTATCGG
GTCGCTAGTGATCTCGGTAACCATTTACGTGGGAGTTTCGCTCGTCGTGACCGGAATGGCACCTGTGGATGTACTGGGGAATGAGGTACCTCTTGTAAAC
GCGTTCATCTTCCACGACGCCCCATGGGCTGGACGTATCGTATCGTTTGGCTCCATTTTCGGTCTTACTACTGCTGCGTTTACCTGTCTTTTGGGTCAAC
CGCGTATTTTCTACCAGATGGCCAAGGATGGTTTGCTGCCCTCAGTCTTCGCTAAATTGCACATCAGGACCCATGTCCCCGTTGCTAGCACAATCTTCAC
TGGCATCCTGGTTGCCTCCATCGCGTTGGTTTTCGAGCTTGATTTCTTGGCCAATGTGATTTCGTGCGGAACACTGCAAGTCTTCACCTTCGTCAATGCT
GGTGTCCTACTTTTGCGCATGCGTCCGAGTCTCAGTGGCGCTGGTGTCGTCCGCCGCGTTCTGCTGTACGTGATAGCGTGTTTTGCTCTGTCACTGTCCT
TCGTGTTCGATCTCTCGTGGACGGTTCAAGGCGCGTTCGGTATGATGGTGATTGCTTCGTTTGTGTATATCTACCGACTCGAGAAACTCAGGTGCGCAGC
AGTGTCAATGCTTGTACCACAATGATGAACAGCTCTAACATGTTTGCCTCTTCGTTTTTCAGTGATCTGACCTCGTCGTTCCAGTGCCCATTGGTGCCGT
TCGTCCCATGCGTGGGCATCCTGGCCAACATCTTCATGATGGCAAGCATCCCAGGCGAAGGCTGGTACGTCTGTGTGGACTCCGAAGTGTTTTTCTTGAC
GCTAACGTGCAATTTTTTTAAGGATCGGTGTGCTTATCTGGCTGAGCGTGGGGCTGGTCGTGTACTTGTGCTACGGGATCCGCCACAGTGTGCTAAACGA
TATTTCCTTGTTACGCCCACTACTTTAAAGTCATCGTCACAGCATGCCACCAAACCGGCCAGAACATAGAGTATCACGCCTACAATATCATGCGGTTCGT
GAGTACGGGGTCGCTCCGCGTGTTCGAGATCAACGGAAAGAAGCAATCAAGGGGGTGAGCATGTCAGAAGTACCCGGGTTACGGTGGGCTTCCTCGGCTT
CGTGCATCTGCAGCTGGTAGATAGACGAAGTGTATGACTGTAATGTACTACAGTAGTAATACAATATAATGCAATCATATTATATTACTCTCTATGACCA
TAATATAATAATAGTATCTTATATGAAAATCCTTTACCGGCATTTTGTACTTCGAAGTATCTATTTTGATCACTTACATGGTAGCTGAGCAACATTGAAG
ACGTGCTCGACACTGTGGACATTGCGTATTGCGTGCAGCGTCAATGCCCTCATCTATTGAATGCCTCCTACGTTTCCAACTGCCTAGACCCGATGTCGAC
GACGACGACCGGGTTGATAGTGGCGATGATGTCAGTCTTGACAACCTGTCAGCCAGATCTGGCGACGACAAAATGCTGGAGCTCTATCGTCAGGCGGTGC
CTCTCGTCCAGCCTCATTCGACGGCTGCAGTCAAAACACTGGGGGCGATTGTACACGACCGCGAGCTAGTGAAGCGAATGTTGCAGCGCCCGCAGCCGTA
CGCCAAGCAGCTCGATAGACGACCACTCGCTTACGAAAGCCCTGCATCAAGACCTCCGCCACTTTCTGCTTTGCCGGTCTCACCTGGGAGTGGACTAGTC
ATCGGTAACCAAAGCAGCAGCCACCGCCACATGATGTTCATGGCTGCGTGCGAGAAGCTCATGGTGACTTTCGATCCCCAGGTGCGGCATACTCGACGCG
TGAAGCTTGCGCAGATCAAGCCATTGCTGCGCTTTCACGGCTTGGAGGTAGATAACGCAGCTTTTCGCCGGTGGGAGCAGCGATTGCAGCTTTCAACTGC
TTCCGAGCTAGCGACAACGATAGGGCCGGTAGTCTCGGTCAGTGACTTTATTCAAGCGTGCCAGCTCTGGTTTACCGAGACATTCGTCATCGACCACGT