Description :
From Genome Similarity Track
Location :
Scaffold_102:70644- 72222
Transcript NameFunction/comments
Phyci_95754Hypothetical protein

Sequence
1578 bases(100 bases per row)
AAGCGCACGTCCATCCAGGCCAAGATCGACAAGCGCCGCAAGGAGAAGGAGGCCGAGAAGCAGGCCAAGAAGGAGAAGAAGGCGGCCAAGCTGGCCAaga
aggagaagcagcagaagaaggaggaggaggaagagaagagtggcagtgaagaggaggacgaggaggaggagAACAGCGACTCCGAAGAGGAGAAGGATGG
TGACAGCGACAGTGAGAGTgaggacgagaaggaggaagacgatgaggagtcgtcggacgatgagaaggagcaggacgtggaggaggaggacgtggtggtg
gaggaggagCGTCTCCAGTCCGCACTGAAGGACAGCAAGAAGGACCAGCAGTCGCGCGAGGAGCTGGTGGACGCGCTGGAGAAGAAGAAGGCTGCCGAGT
TCTTCGAGTCGGACCCGTTCGCCGCGGAGGAGTTCGCCAAGACCAAGTTCGAGACTTTCGCCGACCTGAAGCTGTCTCGCCCCATCATGCGCGCCATCTC
GCACATTGGCTTCGAAAAGCCGACGCCGATCCAGCAGCGCGCGATCCCTATCGCGCTCACAGGCAAGGACATCTGTGCTAGCGCCCAGACCGGTAGTGGT
AAGACCGCTGCCTTCTTGCTGCCCATTCTGGAGCGTCTGCAGTTCCGCTCGCGTCGTGTGCAGTCCACGCGCGTGATGATTATCTGTCCCGTGCGTGAGC
TAGCGACGCAGTGCCAGTCGATGTTCGAGCAGTTGGCGCGCTTTACGGACATTACGATCTCGCTGGCTGTCGGTGGTTTGCCTCTGAAGGCTCAGGAAGC
TGAGCTGCGCAACCGCCCGGACGTTGTGGTGTGTACCCCTGGTCGTATGATTGACCACCTGCGTAACTCGAAGAGTGTGCACATGGACGATCTGGAAATT
CTCGTGTTGGATGAGGCGGATCGTCTGTTGGAGTTGGGTTTCACGGAGGAAGTGCTCGAGCTGGTGCGAATGTGCCCCGTCCAGCGCCAAACGATGTTGT
TTTCAGCTACGATGACATCGAAGGTCGATCAATTGATTGACTTGTCGATGAAGCGCCCTGTGCGTATCAGTACGGACCCGTTGTTCGACATGGCCAAGCA
CCTTGTCCAGGAGTTTGTGCGTATTCGTCCGAACCGTGAAGATGACCGCGAAGCCATTTTGCTGGCGCTGTGTACGCGCACGTTCCGCACGAACACAATT
GTGTTCATGGAGACCAAGACGCACGCGCACCGTATGATGATCATTTTCGGCCTCGCAGGCATTAAGGCTGCGGAGCTTCACGGCAACCTGCAGCAGAGGG
AGCGTCTGGAGGCGCTCCAGAAGTTCCGCGACGGCACGGTGGATATTCTTCTGTGTACGGATATCGCTGCTCGTGGTATCGATGTGCGTGGTGTGCACGC
CGTTATCAATTACGAGATGCCCAAGGACATTACGACCTATGTTCACCGTGTCGGTCGTACGGCCCGTGCTGGCCGCAACGGTCGTGCTGTCACCCTTACG
AGTGAGTCACGCCGTCTAGTTATGAAGCAAGTGTCGCGTCACTGCAAGGGCTTTGTCAAGTCCCGAGCTGTCCCTGAC