Description :
From Genome Similarity Track
Location :
Scaffold_7:70613- 72159
Sequence
1546 bases(100 bases per row)
TAATAGCGAGCTTCTTCCCCGAAGCGACCAACGCCTCCGCAGGATTTCTCGCCCGCAAGATTAGCGAAAAGCTGGAGGACATCATGGCGAGCGGCAAAGC
ATAATCAGAGCATATGGAGCGCGCCAGCGGCTTTGCCCGCGATATAGCCGGCCGCGATGATGAACACGCCGGTGGCGTGCCGTCGTTTTGACTAGGCCGC
CTCAACTGGCAGACCTCGCTCGAGGGAAGCGCATCACTTCCTCGGCAGTGAATGGCTCGGCGCAGGAACGGCGAGACCCACCCAGGCATCCGGACTGGCG
TCGGTCTCCCATCGGAGGAGAGGATCGCCATGCAGCGCCTCCGTACGTACATACCATATAGTTTACACTTGCCGAATGTAGGGCTCTATTGTCAAAATGT
CCGCCGCTATTGTCGAAATATCCGGAGGCAAAGACGACTCATGTTCAACATGCGCAGGCGAAAGTATAGCATCATTCCTGCTGAGCCGCAGCTTTTCCTC
TGGCGGCTTCGAGGTTCAGTCTCGGCAGTATGCGCTGCTGGTTTTTGCGGTGGCGTGGTTCGCGCGACCGGATTGCAGCGGCTCGATCCGCTGGCTTCTC
GTCACTTTTCGCCAGCAGCGAATCTCCAGCGCAACCCGATCTTTCATCACTCGCGCGGTGGACAAGGGAAACCTGTCCTCGCGCTCCAGTCTCTGCTCGC
GGCCACCGATTTCTGCAAGGGAGCGCAGCACGACACGGCAAAAAACTAGCCAAGGCACCGGCAGCTTCCGGGGTTCGACAGCTTCTTGCCGACAACAATT
TATTGGCAACAAGGACCCTCGAAGACTGCGGACCGCGCAGAGGGAATAGGCCTGATCACGCGGTGGCCGCTTCCGCCAGTGCTTGCAGGGTGCAAGTTGC
AGCAGAAATGCGCAGGAGCTTCACCTATACTATTTGCGATTGTGCAAACCTATTGTTGACGAGTCTTTAGTCTGGTTGCAGCCACCTCTGCAAAGGTGCG
TGCTCCTGTCACCAATAGGCAGGACGTGGACCGCATCATTACCGTTGAGAAGCACGCGCCTTCCATCGTCGCACCGCCGCCGTCGGCATGCCACCAGTAC
AATAGCAAAGAGGGCTCGTGTCGCTTCGACTGTCGACCGTTGCTGTTATTGCTGGTTTTGTGAACCATCACGAGTGCTTTCAATCCTACTATTTATACCA
GTAGTGAATGCATATTTGCGCAAGCCGCACTCTCTGGTCAAGTTCACAGGGAGTTCAGAGCCGCATGAATGAGCTCTCCACTCCGCGCGGTTTCCTGCAT
CGCTGCCGAGTCCGGGCGGTCAGGTGGTTGTAACGCAGCGCCTCTGTACCTGTATTGGCCGTCGTTGCTCGCTCTCAATGAATACCCGCCCGCCCGCAAG
TCCGAAAGCTTTTCCCGCGGTACCGTATTGAAACCAGTAACTCAGGTGTCGCCGCAACTCAGGCGAGAAAGCCTCAACGCCATACTCGAATGCCGTTGGG
CCAGTGACACTGAGCGAGTGTTGCGTTCCAAATTGGAACGCAGCAC