Description :
From Genome Similarity Track
Location :
scaffold_18:7061- 8689
Transcript NameFunction/comments
g1017.t1 Voltage-gated Ion Channel (VIC) Superfamily
g1018.t1 hypothetical protein PHYSODRAFT_472012

Sequence
1628 bases(100 bases per row)
ACGATGGCGAAGACCCGCTCGTGGGTGGTGGTAGGGTGTACGTCGCCGTAGCCTACAGTCGTCCTGCGTTTTTCGTTTGTGTGAGACTACTGTAGAATGG
TTAGAAGTAATTTTTGACGTACATGGTCATGATGGCCCAGTAGAACGACGTCACGTACTTCTCGTACAAATTTGTGTCTTGGAGATCCATTGCAGCGACC
CACCCGTCGTCTTCGTCGTAGCTGATGAGGAAGAAAAAACAACTACAAAAACATAAAGTTAGGTCCTGTTCTACGAGAGATGGTAGAATGACTACAGGTA
GTACCTGAGCCAGTGCGACGTAAAGCACACGAGCATGCAGAATTTAAAGATGCTGCTGACTGTAGATCGCAGAAGGAGAGCGTAGTCGAGTCTACAGTAC
CCAAACAATTAAGATAAAAACTACGAGTTGAACGACACAACCCACTCACCTGTTGAGAATGCGCGTGATCGTAAGCATCCGAACGAGGCGAAAGAGTCGA
AAGAGCCGAAACAATCGTGCGAGTTGAGGGATGCGGAAGTAGGAGCCCTGGATGTAGTACAGAGGGAAGGCGGAGACGAAGTCCAGCAGGAACCACGACT
TGAAGTATTTCCGAGCAATCGCCTGCAGCTTCGCCTCAATCTGACCGCGCTCTTCGTAGGCGGACAAGAAGTTGACGATCTTCACTCGTGTTAGAAAAGA
TCAGGAACTGGAATAAAACATATCAAAAAAGGACGTACGATATCTGAGATGAAGAAAAAGTCGATGACTCGCTGTACGTATTCCATCCCCACTAGCGACT
CTGGTACGGAGGCTCCAAACGATAACTGGAACTGTACGACATTCCCAAACGTTTAGAATTGAACCAGAAAGAGAAAATGAAAACCACAACTTACAGGGAT
ACTAAGTGAATTATCTGTACGTCAAACAGAAAAAGAGGTTTCGTCAGTAAGGTAGTTCATGTCTAATACAAAATTTCACCTACAGCAGATGAACGAGACC
GAGAGGAGGTCCCACCGCACGCGGAACTTGCCGTGTGGAGAGATAATGTACTTGGGCACAGCGGATTCGTCGAACTTCTGCTTCTTCTTGTTGATAATCA
GTTCATTCTTCGAAACAGTCTCCACAAAGTCCAGTGCTTCCGCTGGTGTAAGATCGTCCATGTCCCTCTCCAGCCTCTGGTCCTGGAACTCACTGATCTT
TCCGTCTGCAGGCCGAATCGCAGCCACTTTGGCTCTGTTCTTGGCCTTGCGGATCATATCCCTCATCGTCACCAGCTTAATGAGACTCGTTTGTGTGAAC
TGCTGGTGCAGAGTCATTCGACGCGCAGGCTCTGCCAACGGAGGAAGACGAGCTGCTGCCTTGGCTCGCAGTTCATTCTGAGCCAAGCGCATCTCCTCAA
TAGGCGAAAGCCCCGTCATGTGGGCGCGTTCGGCCTGACGCGCCATGAACGGAGACTGAGACATACTCGCAAGGCGAGAGGCATCCTGCCCCGCTTCCTT
CCCGCGTTCGGGTTGACGTTTATTCGTCGCCATGGACCAAATTCCAATTGAGAACGCAAAGCGCCGGGTGGTTTCAGTCTTCAGTAGACAATTTGAGCAA
CATGCCGCACCGACACTCGATCACTGGT