Description :
From Genome Similarity Track
Location :
Scaffold_2588:706- 2873
Sequence
2167 bases(100 bases per row)
TCTCAACTTTCAAGATCCCGTCACAGGAGGCGGCAAGTACGACTTAAAGGACAACACAAAGGCAAGGGAACACACCCGCAAGGCAACCCTACGGCCAGAT
CCACGATCTAGGCCCCGGATCCATAAGCTCGAATATTCGCTTAGGATATGTGTATTCATCCACGGACGCAGAGTGAAGATTTTCCACTGCTGCTCCACCC
CATCCCCACGTCTCGCCAAGACACTCAAGCTTCACCACTTGAACTCTTCGGAAGTTACCGAGAGAGCAGATCCCGCCCTACCGACGGGTACACAAGGTGA
GGAAAGTTCAGCAGAACACGGATCATCGGGGGACCCCCTCCGTTAGTCGGTGTCTGGGCGCAGTTGGTAAGTTGGATCTGGCAATCTCGCAGATTTTGCT
GATCCCGCTACACCACAATGGTGCGCGTGCCCGGATCTTTTGGTGACTCGGGATTTCACCGTGAGTCCCAAGAAGATGCTCAAGTGAAGATTTAGCCAGG
GGAAGAGGCGTCGTCGGAGGTCGGATCGACGAAGACGCTGCTGAATGAAACAAGATCCGCGGATCGATGGAGTTTTGGGAGGAACTCTGTCGACGGAAGA
GAGGTGGATCCGGATCCGGATCTAGAAGAGAAACCTCTCTATCCTCCCCAGGTCCCCTCGGGGACCCCTGCGGATCTTGACGCAAGTCAAGATCCGCTAA
CAAAACAAGGGAAAGTGAAGGCGAAACGGTATGCATTTGCAGATGCACCGGTTAAGCCAACACCGTACCTAAACCCAAGCCCGCTAGTCGAAGAAACAAG
AAAGAAAACGAAAACGAGTAAGACTACGCGGAAGAAGATGCAAGCTCCAGAGTCGGAAGAAGACCAAGCTGGATCCAGGTCAAGCTGGTCCGACAAGGAT
CTCGAGTTTGTGTATCGCCACCAAGCTTTACGCGACTTCCTGCATCAAGATCCTGTCATGCAGATCCTGAATCCACGACAGATCGAAGATCCAAGGGAAC
CGGTGAGAGCACCAACGAAAACGGCGAACAAGTTGGTGGCAGTCAAGGATCTATTACGTTTGCTTACGGAGTCAGGCATCGTAGCTGGTGTGTTCGACGC
AGAGGATATCTTCGAGCTAGATCTGGATCTCATAGCATCCGCGACGCAGGACCTCTTTGCCAGAGTTAAGTCCATCACCGGAGAAAAGGTCGCGCACTAT
GGATCCAGTGTCATCGCCGAGGATCAGCCAAGCTGCGTCCTCGAACTACCAATCCGCCGCTGAGGATGAGTCAGACACGTCGTCCGAACCACGACGCATG
ACTTTAGGACCCTCCGGGGCATCCATGCTGGAAGCGCGGGCGAGGATCCGAGGACAGGAAGCCCCTGTGAACGTGAAAGCTCGGGATCCAGTACGCCCTA
CGCGTGATCTGACACAATCCAGCCAGGATCGAGCCAGATCCGGCAAGAAGCCAGTGGGATTATCGTCAGATCAGGCTCGAGGTAATCGCCTCACGGATCC
AGTCCCGCCAGTGGACCAGACGGCCACAGGCTCTTCCGACACTTCCTCGGGCACCCTGCAGCGACACTTCGAAGCTGCGATGAGTCGTTTCCTGGCCGAA
CAGGGTATGAGAGCGCCCCGTGCCACAAGTGCAAGTGCTCCACGAACATGGAGCACGAGACGTGGAGATGGAGTCCGTGGAAGGAGACAACTCCCATGAT
GAGTTCGACCTAGATGATCTGGATGGCCCATCCACTTCGTCAGCAGTGGTAGCAACAGCCACAGCCGGGGCAGGTAGATCGTCCATGATCCAGAGGGTAC
GGATCTCAGCCATATCGGATCTGAAGGAGTTCACAGGTAAGGCTCAAGACGAGGACCGAGCGAAAACATGGATCAGCAAAGTCAAGTCGGCCCTCATGAG
AGATCAAGCGTCAGATGCTGAGAAGTGTCTGACGTTTGTGGATCTGCTATCGGAACCAGCCGGAAATTGGTATCGGCAGCTGGGCAGATCCACCAGGAAC
AAGTGGCCAGATTTGCTGTGCAGTTTCCAGACCCAGTACTGTGGATTGGGAGTGTCGGTGGCACAACAGTACTACCATGCTCGCCGCAGATCGGATGAAT
CCCCGCTAGAATATCTGCATCGACTAAATGTGGCCGGTCTACGGGCAAAGTTGAAGATCAAGGATGG