Description :
From Genome Similarity Track
Location :
Scaffold_1030:7059- 8261
Sequence
1202 bases(100 bases per row)
TGAGCCGGCTCACGAACGGTTGTACACCGCCGGCAGCAGCATAGGCTGTAACCTGTGACCCAGGCTGTGACTCACTTGCATGTTAACGTGCAGTATCCAA
TTCGAAGTAAATACATTACTCGTTGGGGACGAGATTTTGCAATCAGAGAGTTGCAACTGTGCGTTCGGTGACAATTATGAGGATATCTGAAACTAGGGCT
AGCCGTAGACTGGAATATAGCCAATATCGAAATTCGTGTAGGCGGGCATAATATGCCCGCCTACACGAATTTTAGGAATGCTGAGTTAAAGTGCTTTACC
GTTCGCGTATCTCCTGCGGCTGCGAAGCAGCCGCAACATCTACGCAGACTTTCACTATTGACCTACCGACCATTGTATAATTTTGACATATAGTTTTGAA
CTATTTGAGGTTGTGAGCTGTCAAAAGCGAAAGCTAATGCTCATAATCGGAGACCCGCGGTGCCGCCTAAAAGTTGTAACTTTTTGAAACCGGGTTCAAT
AGGTACCTAactacgcacttggcatgcgttcgatgcattccaaaacccaatatcCCACTCAAACAAACCATAATCaaatcaacaaaccttcaCATAGACA
aaccaagtgagtagcaaccaggaataaccagttaatcaactcaatttccttccttgAGCACGTTCATCTATTGAAGTTTTTGTACAGCAAGGGAGGGTTT
CTCCCGAGGTGATCAGCGAGGAATTTCCCAACGCAGCGAGATCCTGCCACGTCGATGCTGTGGAGTTCCTGTACTCCTGATCTCGCCCAAGCTGGTTGAT
ATGGCGTTTAAAAAAGCTGGTGTAGCTTCGAAGCTTCCAACGGTAACGATCTCTACGCCATGGAATCGTTGTTCTACAGTGGATGTTTCTcccagttgct
gcttcaggaGACATTGCGGATGCGCTCTTCTCTTCCAAATgagtgttgttgttgtgagGCTGAAACAAGAGAGCGACAGGCATGTCGAAAACTATCAAAT
TCAACAATGATGCGCATCATTTTCGATTTCATCTCCTCAAGCATGAGGATCGTTGTACACATCAAATGAGTTTGTCCCTACATTCGTAGTATACGGGATA
ACTGCATTGAGTTTGTTGTAAACTCGTTTGAACGCAGGTGTGGGTGTCTATCGCACGAGTTGACTTCTTTTGAAGCCAGTAAGAAGTAAACGTTGCTCTC
AC